Incidental Mutation 'R0645:Cep350'
ID57027
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 038830-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.838) question?
Stock #R0645 (G1)
Quality Score186
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 155940712 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124495] [ENSMUST00000138762]
Predicted Effect probably null
Transcript: ENSMUST00000124495
Predicted Effect probably null
Transcript: ENSMUST00000138762
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.6176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1740:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- ACTGGCAAGAAGACTGACATTCTGATG -3'
(R):5'- GGTGCTAAATGGGAGTCTAATGGTGG -3'

Sequencing Primer
(F):5'- tgagtgagaaggagaaagtgag -3'
(R):5'- GGCTGTCCATATTTATGCATTTCAG -3'
Posted On2013-07-11