Incidental Mutation 'R0645:Esrrg'
ID57030
Institutional Source Beutler Lab
Gene Symbol Esrrg
Ensembl Gene ENSMUSG00000026610
Gene Nameestrogen-related receptor gamma
SynonymsERR3, estrogen-related receptor 3, NR3B3, Errg
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0645 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location187608791-188214885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 188043341 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 22 (C22S)
Ref Sequence ENSEMBL: ENSMUSP00000027906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939] [ENSMUST00000127489]
PDB Structure
crystal structure of the ligand-binding domain of the estrogen-related receptor gamma in complex with diethylstilbestrol [X-RAY DIFFRACTION]
crystal structure of the ligand-binding domain of the estrogen-related receptor gamma in complex with 4-hydroxytamoxifen [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000027906
AA Change: C22S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: C22S

DomainStartEndE-ValueType
low complexity region 57 70 N/A INTRINSIC
ZnF_C4 125 196 4.04e-40 SMART
Blast:HOLI 203 233 5e-6 BLAST
HOLI 270 428 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110938
SMART Domains Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110939
SMART Domains Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127489
SMART Domains Protein: ENSMUSP00000119286
Gene: ENSMUSG00000026610

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
Meta Mutation Damage Score 0.072 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Esrrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Esrrg APN 1 188210910 missense probably damaging 1.00
IGL01635:Esrrg APN 1 188198600 missense probably damaging 1.00
IGL01642:Esrrg APN 1 188210915 missense probably benign 0.01
IGL02740:Esrrg APN 1 188198741 missense probably benign 0.04
IGL03126:Esrrg APN 1 187997987 intron probably benign
IGL03391:Esrrg APN 1 188150223 missense possibly damaging 0.70
R0395:Esrrg UTSW 1 188198635 missense probably damaging 1.00
R1593:Esrrg UTSW 1 188066385 missense possibly damaging 0.94
R1700:Esrrg UTSW 1 188043653 missense probably damaging 1.00
R1855:Esrrg UTSW 1 188211098 missense probably damaging 1.00
R3552:Esrrg UTSW 1 188150190 missense probably benign 0.05
R3605:Esrrg UTSW 1 188211102 missense possibly damaging 0.74
R4384:Esrrg UTSW 1 188043711 missense probably damaging 1.00
R5255:Esrrg UTSW 1 188146358 missense probably damaging 1.00
R5443:Esrrg UTSW 1 188043425 missense possibly damaging 0.78
R5511:Esrrg UTSW 1 188211107 missense probably damaging 1.00
R5516:Esrrg UTSW 1 188198730 missense possibly damaging 0.56
R5543:Esrrg UTSW 1 188150254 missense probably damaging 0.96
R5686:Esrrg UTSW 1 188150198 missense probably benign 0.24
R5990:Esrrg UTSW 1 188198798 missense probably damaging 1.00
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R7058:Esrrg UTSW 1 188150306 missense probably damaging 1.00
Z1088:Esrrg UTSW 1 188150218 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGTCTCAGCCCTTAGGAAGCACTC -3'
(R):5'- AAGCACAGTCTCTTGGGCATGG -3'

Sequencing Primer
(F):5'- CTTAGGAAGCACTCTTAAAGAGC -3'
(R):5'- TGCTGGAGCAGTCATCATAC -3'
Posted On2013-07-11