Incidental Mutation 'R7347:Nbr1'
ID570301
Institutional Source Beutler Lab
Gene Symbol Nbr1
Ensembl Gene ENSMUSG00000017119
Gene Nameneighbor of Brca1 gene 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7347 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location101552149-101581951 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 101569321 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 381 (L381*)
Ref Sequence ENSEMBL: ENSMUSP00000099388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071537] [ENSMUST00000103098] [ENSMUST00000103099] [ENSMUST00000107208] [ENSMUST00000107212] [ENSMUST00000107213] [ENSMUST00000107218] [ENSMUST00000123558]
Predicted Effect probably null
Transcript: ENSMUST00000071537
AA Change: L381*
SMART Domains Protein: ENSMUSP00000071467
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 2.05e-8 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
Pfam:N_BRCA1_IG 378 479 7.1e-34 PFAM
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000103098
AA Change: L381*
SMART Domains Protein: ENSMUSP00000099387
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000103099
AA Change: L381*
SMART Domains Protein: ENSMUSP00000099388
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107208
AA Change: L381*
SMART Domains Protein: ENSMUSP00000102826
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 1e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107212
AA Change: L381*
SMART Domains Protein: ENSMUSP00000102830
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 3e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 689 719 N/A INTRINSIC
PDB:2MJ5|B 910 956 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107213
AA Change: L381*
SMART Domains Protein: ENSMUSP00000102831
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 677 707 N/A INTRINSIC
PDB:2MJ5|B 898 944 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000107218
AA Change: L381*
SMART Domains Protein: ENSMUSP00000102836
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 5e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
PDB:2MJ5|B 935 981 2e-24 PDB
Predicted Effect probably null
Transcript: ENSMUST00000123558
AA Change: L381*
SMART Domains Protein: ENSMUSP00000133619
Gene: ENSMUSG00000017119
AA Change: L381*

DomainStartEndE-ValueType
PB1 4 86 7.02e-16 SMART
ZnF_ZZ 212 257 1.21e-13 SMART
coiled coil region 291 330 N/A INTRINSIC
PDB:4OLE|D 368 486 2e-77 PDB
low complexity region 507 518 N/A INTRINSIC
coiled coil region 714 744 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000149019
AA Change: L140*
SMART Domains Protein: ENSMUSP00000119900
Gene: ENSMUSG00000017119
AA Change: L140*

DomainStartEndE-ValueType
coiled coil region 50 89 N/A INTRINSIC
Pfam:N_BRCA1_IG 138 239 2.3e-34 PFAM
low complexity region 267 278 N/A INTRINSIC
coiled coil region 473 500 N/A INTRINSIC
PDB:2MJ5|B 659 705 1e-24 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was originally identified as an ovarian tumor antigen monitored in ovarian cancer. The encoded protein contains a B-box/coiled-coil motif, which is present in many genes with transformation potential. It functions as a specific autophagy receptor for the selective autophagic degradation of peroxisomes by forming intracellular inclusions with ubiquitylated autophagic substrates. This gene is located on a region of chromosome 17q21.1 that is in close proximity to the BRCA1 tumor suppressor gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous mice of the genetic truncation allele had an age-dependent increase in bone mass and bone mineral density. Mice homozygous for a floxed allele activated in T cells exhibit decreased ovalbumin-induced inflammation and defective Th2 polarization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T A 9: 103,282,646 E22V possibly damaging Het
4930564D02Rik G T 3: 105,078,412 R47S unknown Het
4931408C20Rik A T 1: 26,684,467 L544Q probably benign Het
Abtb2 T G 2: 103,567,412 I229S probably damaging Het
Adgre1 T C 17: 57,420,441 L457P probably damaging Het
Amer3 C A 1: 34,587,902 D407E probably damaging Het
Arhgap20 T C 9: 51,849,035 S729P probably benign Het
Asap2 T G 12: 21,229,457 I418S probably benign Het
Brinp3 T A 1: 146,902,086 V757E probably benign Het
Brip1 C T 11: 86,139,103 G572R probably benign Het
C3 C A 17: 57,223,215 R462L probably benign Het
Cat T A 2: 103,463,298 H395L probably benign Het
Cela3a T C 4: 137,402,606 N235D possibly damaging Het
Cntnap1 G T 11: 101,185,268 G993W probably damaging Het
Coro2b G T 9: 62,489,372 H29N probably benign Het
Dll3 C T 7: 28,299,111 R143H probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dync1i1 T A 6: 5,784,530 *114R probably null Het
Ecm2 T C 13: 49,515,078 S86P probably damaging Het
Exph5 A G 9: 53,375,896 N1426D possibly damaging Het
Eya2 T C 2: 165,687,666 F110L probably benign Het
Flt1 T A 5: 147,580,381 E1032V probably damaging Het
Galnt5 A T 2: 58,017,193 H556L probably benign Het
Glb1l3 A T 9: 26,829,003 Y344N probably benign Het
Glrx3 C A 7: 137,459,286 D216E possibly damaging Het
Gm45871 T A 18: 90,591,375 C246S probably damaging Het
Gm8251 G T 1: 44,059,496 P814Q probably damaging Het
Gm906 T C 13: 50,245,744 I849V probably benign Het
Gstm4 A G 3: 108,042,373 L137P probably benign Het
Hsd17b13 T C 5: 103,968,750 T169A probably damaging Het
Hydin A C 8: 110,600,362 T4778P probably benign Het
Ifna15 A G 4: 88,557,983 L88P probably damaging Het
Kcnab1 G A 3: 65,376,531 R390H probably benign Het
Kng1 C A 16: 23,067,787 H161N possibly damaging Het
Lamp5 T C 2: 136,060,958 V199A probably benign Het
Lrig3 G A 10: 126,009,966 V755M probably damaging Het
Mad1l1 C T 5: 140,144,044 R412H probably damaging Het
March6 C A 15: 31,486,359 C350F probably benign Het
Mastl A G 2: 23,133,389 S441P probably damaging Het
Mfsd13b A T 7: 120,991,728 M231L probably benign Het
Micalcl T C 7: 112,382,151 V444A probably benign Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo15 A G 11: 60,477,961 M516V probably benign Het
Myo1b A T 1: 51,751,254 F1110L probably damaging Het
Nln T C 13: 104,050,847 K325E probably damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Nrp2 C T 1: 62,745,504 P271S probably benign Het
Obox6 A C 7: 15,834,646 L102V possibly damaging Het
Olfr1008 T C 2: 85,689,837 M136T probably damaging Het
Olfr1208 T C 2: 88,897,271 I109V possibly damaging Het
Olfr1241 T C 2: 89,482,455 S227G probably benign Het
Olfr853 A G 9: 19,537,099 M277T probably damaging Het
Pde10a A G 17: 8,967,462 H567R probably damaging Het
Pdgfra C T 5: 75,183,098 S760L possibly damaging Het
Pid1 T A 1: 84,159,129 I94L unknown Het
Plekhn1 T C 4: 156,222,671 H474R probably benign Het
Prcc A T 3: 87,869,681 S329T possibly damaging Het
Pros1 G T 16: 62,919,523 R445L probably damaging Het
Pxdn C A 12: 30,012,261 H1370Q probably benign Het
Sgce T A 6: 4,694,106 R283S probably damaging Het
Slc25a20 T G 9: 108,682,458 probably null Het
Slc6a1 T C 6: 114,311,818 V446A probably damaging Het
Slc6a4 C G 11: 77,017,085 Y358* probably null Het
Sned1 A C 1: 93,281,736 E857A probably damaging Het
Spdye4b C T 5: 143,202,390 R213C possibly damaging Het
Spry2 T G 14: 105,893,512 E80A probably damaging Het
Stard9 G A 2: 120,666,534 C142Y probably benign Het
Sync A T 4: 129,294,306 Q377L probably benign Het
Tdrd12 A G 7: 35,485,692 C718R Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tmbim1 T C 1: 74,291,279 E185G probably benign Het
Tyk2 T C 9: 21,108,034 M1031V probably damaging Het
Vmn1r71 C T 7: 10,748,501 V87I not run Het
Vmn2r49 A G 7: 9,986,814 V250A probably benign Het
Yipf3 A C 17: 46,250,827 T187P probably damaging Het
Zfp148 G T 16: 33,434,790 R50L possibly damaging Het
Zfp628 G A 7: 4,921,818 G1013E probably damaging Het
Other mutations in Nbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Nbr1 APN 11 101569359 missense possibly damaging 0.91
IGL02192:Nbr1 APN 11 101569591 missense probably damaging 1.00
IGL02259:Nbr1 APN 11 101577990 missense probably damaging 0.99
IGL02951:Nbr1 APN 11 101571979 critical splice donor site probably null
IGL02994:Nbr1 APN 11 101556227 missense probably damaging 1.00
R0087:Nbr1 UTSW 11 101564693 missense probably benign 0.16
R0630:Nbr1 UTSW 11 101567087 unclassified probably benign
R0723:Nbr1 UTSW 11 101576319 nonsense probably null
R0733:Nbr1 UTSW 11 101576371 missense probably benign 0.00
R1482:Nbr1 UTSW 11 101572841 missense probably benign 0.34
R1567:Nbr1 UTSW 11 101575211 missense probably damaging 0.98
R1570:Nbr1 UTSW 11 101564830 unclassified probably benign
R1668:Nbr1 UTSW 11 101569766 missense probably benign 0.00
R1759:Nbr1 UTSW 11 101559543 missense probably damaging 1.00
R1903:Nbr1 UTSW 11 101575152 missense probably damaging 0.98
R1927:Nbr1 UTSW 11 101567214 missense possibly damaging 0.78
R2131:Nbr1 UTSW 11 101566191 unclassified probably null
R2211:Nbr1 UTSW 11 101567264 critical splice donor site probably null
R2255:Nbr1 UTSW 11 101572817 missense possibly damaging 0.80
R4270:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4271:Nbr1 UTSW 11 101567222 missense possibly damaging 0.87
R4710:Nbr1 UTSW 11 101575275 missense probably damaging 1.00
R4947:Nbr1 UTSW 11 101575077 missense probably benign 0.06
R5468:Nbr1 UTSW 11 101572464 missense probably benign 0.10
R5554:Nbr1 UTSW 11 101564807 missense probably benign 0.34
R5771:Nbr1 UTSW 11 101559538 missense probably damaging 1.00
R6119:Nbr1 UTSW 11 101567112 unclassified probably null
R6400:Nbr1 UTSW 11 101565774 missense probably damaging 1.00
R6603:Nbr1 UTSW 11 101556105 unclassified probably benign
R6943:Nbr1 UTSW 11 101577951 missense probably damaging 1.00
X0019:Nbr1 UTSW 11 101567124 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGCAGCGTATCTTTGTTTTATGACC -3'
(R):5'- ACAGGAGGATGCTTGTCAGG -3'

Sequencing Primer
(F):5'- ACATGCTGGTGAGATCCATTC -3'
(R):5'- ATGCTTGTCAGGTGCGCC -3'
Posted On2019-09-13