Incidental Mutation 'R0645:Olfr1123'
ID57036
Institutional Source Beutler Lab
Gene Symbol Olfr1123
Ensembl Gene ENSMUSG00000043274
Gene Nameolfactory receptor 1123
SynonymsMOR264-17, GA_x6K02T2Q125-48917235-48918206
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R0645 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87416635-87423211 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87418268 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 71 (Y71*)
Ref Sequence ENSEMBL: ENSMUSP00000154459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054974] [ENSMUST00000216208]
Predicted Effect probably null
Transcript: ENSMUST00000054974
AA Change: Y73*
SMART Domains Protein: ENSMUSP00000058786
Gene: ENSMUSG00000043274
AA Change: Y73*

DomainStartEndE-ValueType
Pfam:7tm_4 44 321 4.4e-52 PFAM
Pfam:7tm_1 54 303 2.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214663
Predicted Effect probably null
Transcript: ENSMUST00000216208
AA Change: Y71*
Meta Mutation Damage Score 0.664 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Olfr1123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Olfr1123 APN 2 87418566 missense possibly damaging 0.75
IGL01067:Olfr1123 APN 2 87418370 missense probably benign 0.00
IGL01526:Olfr1123 APN 2 87418975 missense probably damaging 0.99
IGL01580:Olfr1123 APN 2 87418536 missense probably benign 0.06
IGL01986:Olfr1123 APN 2 87418536 missense probably benign 0.00
IGL02503:Olfr1123 APN 2 87418292 missense probably benign 0.03
IGL02527:Olfr1123 APN 2 87418837 missense probably damaging 1.00
IGL02731:Olfr1123 APN 2 87418707 missense probably benign 0.00
IGL03215:Olfr1123 APN 2 87418068 missense probably benign 0.05
IGL03366:Olfr1123 APN 2 87418243 missense possibly damaging 0.88
R1857:Olfr1123 UTSW 2 87418648 missense probably damaging 1.00
R2175:Olfr1123 UTSW 2 87418156 missense probably damaging 1.00
R3691:Olfr1123 UTSW 2 87418170 missense probably benign 0.20
R4082:Olfr1123 UTSW 2 87418457 nonsense probably null
R4635:Olfr1123 UTSW 2 87418699 missense probably benign 0.05
R4877:Olfr1123 UTSW 2 87418563 nonsense probably null
R5190:Olfr1123 UTSW 2 87418843 missense probably damaging 1.00
R5253:Olfr1123 UTSW 2 87418668 missense possibly damaging 0.64
R6266:Olfr1123 UTSW 2 87419006 missense probably benign 0.01
R6784:Olfr1123 UTSW 2 87418452 missense probably benign 0.20
R6909:Olfr1123 UTSW 2 87418615 missense probably damaging 1.00
R7255:Olfr1123 UTSW 2 87418942 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTTGAAATGGTAATGGCCTCCACTC -3'
(R):5'- GCACTCTGTGCCTCCAAGCATAAG -3'

Sequencing Primer
(F):5'- gtttgtgtgtgtgtgtttgtg -3'
(R):5'- GTGCCTCCAAGCATAAGGATAAAAC -3'
Posted On2013-07-11