Incidental Mutation 'R0645:Duox2'
ID57038
Institutional Source Beutler Lab
Gene Symbol Duox2
Ensembl Gene ENSMUSG00000068452
Gene Namedual oxidase 2
SynonymsA430065P05Rik
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0645 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location122279247-122298165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122292658 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 503 (I503T)
Ref Sequence ENSEMBL: ENSMUSP00000050314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053734]
Predicted Effect probably damaging
Transcript: ENSMUST00000053734
AA Change: I503T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: I503T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Duox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Duox2 APN 2 122283575 missense probably benign
IGL00790:Duox2 APN 2 122292300 missense possibly damaging 0.63
IGL01346:Duox2 APN 2 122287202 splice site probably benign
IGL01607:Duox2 APN 2 122292319 missense probably benign 0.00
IGL01798:Duox2 APN 2 122281908 missense probably damaging 1.00
IGL02000:Duox2 APN 2 122290709 missense probably benign
IGL02219:Duox2 APN 2 122294664 missense probably benign 0.01
IGL02227:Duox2 APN 2 122285153 splice site probably benign
IGL02276:Duox2 APN 2 122294085 missense probably benign 0.00
IGL02447:Duox2 APN 2 122297468 missense probably damaging 0.98
IGL02806:Duox2 APN 2 122284666 missense probably damaging 1.00
IGL03091:Duox2 APN 2 122289474 missense probably benign 0.03
Bedazzled UTSW 2 122287121 missense possibly damaging 0.76
Immunox UTSW 2 122281871 missense probably benign
minor UTSW 2 122281496 missense probably damaging 1.00
paltry UTSW 2 122283060 critical splice donor site probably null
Recruit UTSW 2 122283897 missense possibly damaging 0.83
stumblebum UTSW 2 122284667 missense probably damaging 1.00
Two-bit UTSW 2 122281002 missense probably benign 0.42
R0049:Duox2 UTSW 2 122296686 missense possibly damaging 0.48
R0244:Duox2 UTSW 2 122291860 missense probably benign 0.00
R0281:Duox2 UTSW 2 122292304 missense probably benign 0.10
R0378:Duox2 UTSW 2 122284583 missense probably benign 0.00
R0383:Duox2 UTSW 2 122291810 critical splice donor site probably null
R0442:Duox2 UTSW 2 122289332 missense probably benign 0.08
R0524:Duox2 UTSW 2 122281836 missense possibly damaging 0.80
R0560:Duox2 UTSW 2 122291554 missense probably benign 0.04
R0562:Duox2 UTSW 2 122289599 missense probably damaging 1.00
R0704:Duox2 UTSW 2 122284768 missense probably benign 0.01
R0963:Duox2 UTSW 2 122287172 missense probably benign 0.03
R1254:Duox2 UTSW 2 122283478 missense probably damaging 1.00
R1442:Duox2 UTSW 2 122281751 missense probably benign 0.20
R1473:Duox2 UTSW 2 122287121 missense possibly damaging 0.76
R1489:Duox2 UTSW 2 122293396 missense probably benign
R1738:Duox2 UTSW 2 122293414 missense probably damaging 1.00
R1748:Duox2 UTSW 2 122287051 missense probably benign 0.00
R1809:Duox2 UTSW 2 122283897 missense possibly damaging 0.83
R1843:Duox2 UTSW 2 122292258 critical splice donor site probably null
R1903:Duox2 UTSW 2 122295351 missense probably damaging 1.00
R1962:Duox2 UTSW 2 122297372 splice site probably null
R2069:Duox2 UTSW 2 122287108 missense probably benign 0.01
R2073:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2074:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2075:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2085:Duox2 UTSW 2 122280967 missense probably damaging 1.00
R3123:Duox2 UTSW 2 122281073 splice site probably benign
R3907:Duox2 UTSW 2 122283060 critical splice donor site probably null
R4572:Duox2 UTSW 2 122281726 missense probably benign 0.00
R4614:Duox2 UTSW 2 122289557 missense probably damaging 1.00
R4675:Duox2 UTSW 2 122280933 missense probably damaging 1.00
R4770:Duox2 UTSW 2 122284916 missense probably benign 0.01
R4817:Duox2 UTSW 2 122296515 missense probably damaging 0.98
R4931:Duox2 UTSW 2 122296755 missense probably benign 0.01
R5138:Duox2 UTSW 2 122297531 missense probably damaging 1.00
R5288:Duox2 UTSW 2 122295136 missense probably benign
R5344:Duox2 UTSW 2 122281871 missense probably benign
R5385:Duox2 UTSW 2 122295136 missense probably benign
R5386:Duox2 UTSW 2 122295136 missense probably benign
R5493:Duox2 UTSW 2 122281496 missense probably damaging 1.00
R5632:Duox2 UTSW 2 122281455 missense probably damaging 1.00
R5742:Duox2 UTSW 2 122284921 missense probably benign 0.00
R6228:Duox2 UTSW 2 122287193 missense probably benign 0.38
R6380:Duox2 UTSW 2 122281002 missense probably benign 0.42
R6398:Duox2 UTSW 2 122296370 missense probably benign 0.06
R6409:Duox2 UTSW 2 122284667 missense probably damaging 1.00
R6527:Duox2 UTSW 2 122294614 missense probably benign 0.29
R6596:Duox2 UTSW 2 122285338 missense probably benign
R6719:Duox2 UTSW 2 122284386 intron probably null
R6981:Duox2 UTSW 2 122291227 missense possibly damaging 0.95
R7036:Duox2 UTSW 2 122280453 missense probably damaging 1.00
R7073:Duox2 UTSW 2 122289307 missense probably damaging 1.00
R7105:Duox2 UTSW 2 122289552 missense possibly damaging 0.93
R7127:Duox2 UTSW 2 122291949 missense probably benign 0.02
R7259:Duox2 UTSW 2 122295176 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCCGCAAGGTGGTGTTTCTGATTTC -3'
(R):5'- GATAATGGCAGCCAAAACTTTGGATGG -3'

Sequencing Primer
(F):5'- AGTCCTCCAGTGACCTCAG -3'
(R):5'- ttccaaatatctctacacagatgaac -3'
Posted On2013-07-11