Incidental Mutation 'R0645:Cdc25b'
ID57039
Institutional Source Beutler Lab
Gene Symbol Cdc25b
Ensembl Gene ENSMUSG00000027330
Gene Namecell division cycle 25B
Synonyms
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0645 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location131186949-131198497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 131191613 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 157 (H157Q)
Ref Sequence ENSEMBL: ENSMUSP00000078784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028801] [ENSMUST00000028804] [ENSMUST00000079857]
Predicted Effect probably benign
Transcript: ENSMUST00000028801
SMART Domains Protein: ENSMUSP00000028801
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 13 109 9.3e-36 PFAM
Pfam:CAMSAP_CH 14 96 7.9e-24 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028804
AA Change: H157Q

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000028804
Gene: ENSMUSG00000027330
AA Change: H157Q

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 379 3.3e-103 PFAM
RHOD 417 531 4.29e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079857
AA Change: H157Q

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000078784
Gene: ENSMUSG00000027330
AA Change: H157Q

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 354 2.4e-78 PFAM
RHOD 391 505 4.29e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145556
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: The resumption of meiosis during oocyte maturation is blocked in homozygous mutant female mice, resulting in female infertility. Male mice do not show an overt reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Cdc25b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Cdc25b APN 2 131188140 missense probably benign 0.00
R0471:Cdc25b UTSW 2 131197284 missense probably damaging 0.99
R0639:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R0673:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R1574:Cdc25b UTSW 2 131191137 splice site probably benign
R4094:Cdc25b UTSW 2 131189117 missense probably benign
R4433:Cdc25b UTSW 2 131191698 missense probably benign 0.02
R4722:Cdc25b UTSW 2 131193351 missense probably damaging 1.00
R4817:Cdc25b UTSW 2 131193303 missense probably damaging 1.00
R4957:Cdc25b UTSW 2 131193605 missense possibly damaging 0.80
R5345:Cdc25b UTSW 2 131192596 missense probably benign 0.18
R5407:Cdc25b UTSW 2 131193647 missense probably damaging 1.00
R5562:Cdc25b UTSW 2 131194758 missense probably damaging 1.00
R5594:Cdc25b UTSW 2 131191618 missense probably damaging 1.00
R5792:Cdc25b UTSW 2 131191759 missense probably damaging 1.00
R5831:Cdc25b UTSW 2 131187381 critical splice donor site probably null
R7204:Cdc25b UTSW 2 131191632 missense probably damaging 1.00
R7292:Cdc25b UTSW 2 131191173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTTTGAAGTAGCCAGGCATTC -3'
(R):5'- TGTACCATCAAGTCAGGGGCTGAG -3'

Sequencing Primer
(F):5'- GTAGCCAGGCATTCCTGTACC -3'
(R):5'- AGCTCCTGTGGCATCTTGAAG -3'
Posted On2013-07-11