Incidental Mutation 'R7350:Cr2'
ID570471
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Namecomplement receptor 2
SynonymsC3DR, CD21, Cr-1, Cr1, CD35, Cr-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7350 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location195136811-195176716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 195155286 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 792 (V792A)
Ref Sequence ENSEMBL: ENSMUSP00000080938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
Predicted Effect probably benign
Transcript: ENSMUST00000082321
AA Change: V792A

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: V792A

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193356
AA Change: V495A

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: V495A

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000195120
AA Change: V792A

PolyPhen 2 Score 0.588 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: V792A

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210219
AA Change: V1168A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930017K11Rik A T 17: 25,946,711 V534D probably damaging Het
Abraxas2 T C 7: 132,874,849 F106S probably damaging Het
Acsf3 A G 8: 122,785,946 T369A probably benign Het
Adgrf5 G A 17: 43,428,444 probably null Het
Aff1 T A 5: 103,847,092 I1052K probably benign Het
Akap8 T C 17: 32,316,575 D155G possibly damaging Het
Alg10b A T 15: 90,227,450 M166L probably benign Het
Allc T A 12: 28,563,409 Q178L possibly damaging Het
Angptl4 C A 17: 33,777,110 L297F probably damaging Het
Arfgap1 A G 2: 180,971,076 K8E possibly damaging Het
Bckdhb T A 9: 84,010,326 V270E possibly damaging Het
Cbx3 T C 6: 51,475,375 probably null Het
Cd44 G T 2: 102,834,262 N531K probably benign Het
Cdh23 A T 10: 60,410,910 D916E probably damaging Het
Cstf3 T C 2: 104,608,956 L38P probably damaging Het
Cyp2a5 A G 7: 26,836,783 E151G probably benign Het
Dbr1 T C 9: 99,582,549 F127S Het
Ddit4 A T 10: 59,951,495 D6E probably damaging Het
Disc1 G C 8: 125,165,102 R631S probably damaging Het
Dnah5 T A 15: 28,235,819 probably null Het
Dnah9 T C 11: 66,080,578 K1595E probably damaging Het
Dnmbp T C 19: 43,901,505 R608G probably damaging Het
Efcab5 G C 11: 77,137,561 P315A probably benign Het
Eif4a2 A G 16: 23,113,262 Y392C possibly damaging Het
F5 G T 1: 164,192,708 K917N probably benign Het
Fig4 T C 10: 41,251,756 M571V probably benign Het
Flot2 T A 11: 78,057,976 I259N probably damaging Het
Gm8122 C A 14: 43,230,601 probably null Het
Gpr152 T C 19: 4,142,964 V168A possibly damaging Het
H1f0 G A 15: 79,028,903 G61D probably damaging Het
Ihh T A 1: 74,948,333 K183M probably damaging Het
Itga2 A G 13: 114,837,202 L1116P probably damaging Het
Kcnj10 A G 1: 172,369,260 T114A possibly damaging Het
Kcnk3 T G 5: 30,621,966 L120R probably damaging Het
Krt14 C A 11: 100,205,100 E211* probably null Het
Lars2 T C 9: 123,427,480 L350P probably damaging Het
Lrba T C 3: 86,351,902 I1408T probably damaging Het
Lrrc27 A G 7: 139,226,106 E229G probably benign Het
Lrrc8e G T 8: 4,235,626 R617L probably benign Het
M1ap A G 6: 82,981,949 D187G probably benign Het
March1 A T 8: 66,468,399 K243* probably null Het
Med16 C T 10: 79,903,197 V252M probably damaging Het
Micu3 T C 8: 40,348,958 S189P probably benign Het
Mier2 C A 10: 79,540,298 M264I unknown Het
Mindy4 A T 6: 55,301,025 N618I probably damaging Het
Mmrn1 C T 6: 60,976,336 Q534* probably null Het
Mroh9 C T 1: 163,076,289 probably null Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mta3 T A 17: 83,708,441 I24N probably damaging Het
Mtmr4 A T 11: 87,600,650 H147L probably damaging Het
Nfam1 T C 15: 83,010,439 K155R probably benign Het
Nlrp6 A T 7: 140,921,278 probably benign Het
Olfr1006 A G 2: 85,674,845 F102S Het
Olfr1153 T C 2: 87,896,409 probably benign Het
Olfr1164 A T 2: 88,093,198 F246Y probably benign Het
Olfr213 A G 6: 116,540,534 E27G probably benign Het
Olfr357 T A 2: 36,996,861 I17N possibly damaging Het
P4ha1 A G 10: 59,350,418 R240G probably damaging Het
Pla2r1 G T 2: 60,458,379 D636E probably benign Het
Polr2a A G 11: 69,741,060 L1060P possibly damaging Het
Ptgdr2 C A 19: 10,940,955 Q279K probably benign Het
Rab11fip2 T A 19: 59,937,421 R121S probably benign Het
Rasa2 T C 9: 96,544,355 S813G probably benign Het
Rassf5 T C 1: 131,178,536 K411E possibly damaging Het
Reep4 T C 14: 70,546,547 Y35H probably damaging Het
Ror1 A T 4: 100,425,943 M402L probably benign Het
Slc32a1 A G 2: 158,614,406 E327G probably damaging Het
Spen C T 4: 141,479,385 E644K unknown Het
Tarsl2 C G 7: 65,658,924 Q281E probably damaging Het
Tcl1 A G 12: 105,218,675 I92T probably damaging Het
Tifab A G 13: 56,176,307 S108P probably damaging Het
Traf1 T C 2: 34,948,233 N198D probably benign Het
Trim35 T C 14: 66,309,205 Y474H probably damaging Het
Trim54 T A 5: 31,137,161 D344E probably benign Het
Ttc28 A T 5: 111,226,037 H1113L probably damaging Het
Vcam1 T A 3: 116,114,562 D617V probably damaging Het
Vmn2r81 A T 10: 79,268,385 T281S probably benign Het
Whrn C T 4: 63,431,959 R507K possibly damaging Het
Zdhhc14 A G 17: 5,726,876 S303G probably benign Het
Zfp292 A T 4: 34,806,839 N2073K probably benign Het
Zgpat T A 2: 181,380,435 V163D Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 195154251 missense possibly damaging 0.76
IGL01326:Cr2 APN 1 195141221 missense probably null 1.00
IGL01358:Cr2 APN 1 195159820 missense probably damaging 1.00
IGL01410:Cr2 APN 1 195163234 missense possibly damaging 0.49
IGL01468:Cr2 APN 1 195168535 missense probably damaging 1.00
IGL01608:Cr2 APN 1 195155220 missense possibly damaging 0.50
IGL01810:Cr2 APN 1 195159595 missense possibly damaging 0.49
IGL01843:Cr2 APN 1 195150914 splice site probably benign
IGL02332:Cr2 APN 1 195160322 missense probably benign 0.19
IGL02934:Cr2 APN 1 195154325 splice site probably benign
IGL02938:Cr2 APN 1 195166388 missense probably damaging 1.00
IGL03149:Cr2 APN 1 195166366 missense probably damaging 1.00
IGL03327:Cr2 APN 1 195169759 missense probably damaging 1.00
IGL03346:Cr2 APN 1 195169759 missense probably damaging 1.00
Pillar UTSW 1 195155888 nonsense probably null
PIT4354001:Cr2 UTSW 1 195166309 missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 195157452 missense probably benign 0.08
R0128:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0130:Cr2 UTSW 1 195166231 missense probably damaging 0.99
R0380:Cr2 UTSW 1 195157407 missense probably damaging 1.00
R0538:Cr2 UTSW 1 195160359 splice site probably benign
R0605:Cr2 UTSW 1 195163596 splice site probably benign
R0626:Cr2 UTSW 1 195171111 missense possibly damaging 0.95
R1135:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R1396:Cr2 UTSW 1 195169253 splice site probably null
R1422:Cr2 UTSW 1 195171125 missense probably benign 0.01
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1467:Cr2 UTSW 1 195157509 missense probably damaging 1.00
R1511:Cr2 UTSW 1 195155272 missense possibly damaging 0.92
R1572:Cr2 UTSW 1 195163314 missense probably damaging 1.00
R1714:Cr2 UTSW 1 195151686 missense possibly damaging 0.46
R1748:Cr2 UTSW 1 195155905 nonsense probably null
R1761:Cr2 UTSW 1 195155123 critical splice donor site probably null
R1824:Cr2 UTSW 1 195157316 missense probably damaging 1.00
R1893:Cr2 UTSW 1 195155187 missense probably benign 0.03
R1990:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1991:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R1992:Cr2 UTSW 1 195154150 missense possibly damaging 0.63
R2191:Cr2 UTSW 1 195163381 missense possibly damaging 0.94
R2276:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R2277:Cr2 UTSW 1 195157368 missense possibly damaging 0.94
R3548:Cr2 UTSW 1 195155888 nonsense probably null
R3743:Cr2 UTSW 1 195149966 splice site probably benign
R3941:Cr2 UTSW 1 195165814 missense probably damaging 0.97
R3963:Cr2 UTSW 1 195159739 missense probably damaging 1.00
R4211:Cr2 UTSW 1 195156328 missense probably damaging 0.96
R4484:Cr2 UTSW 1 195154174 missense probably damaging 1.00
R4546:Cr2 UTSW 1 195171041 missense possibly damaging 0.94
R4791:Cr2 UTSW 1 195155935 missense probably damaging 1.00
R4801:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4802:Cr2 UTSW 1 195163311 missense probably damaging 1.00
R4874:Cr2 UTSW 1 195176570 missense possibly damaging 0.82
R4885:Cr2 UTSW 1 195158731 missense possibly damaging 0.92
R4889:Cr2 UTSW 1 195176585 missense possibly damaging 0.70
R5154:Cr2 UTSW 1 195159446 missense probably damaging 1.00
R5574:Cr2 UTSW 1 195141236 missense probably damaging 1.00
R5594:Cr2 UTSW 1 195157190 missense probably damaging 1.00
R5645:Cr2 UTSW 1 195154273 missense probably damaging 1.00
R5700:Cr2 UTSW 1 195159757 missense probably damaging 0.96
R5929:Cr2 UTSW 1 195171111 missense possibly damaging 0.91
R6237:Cr2 UTSW 1 195157502 missense probably damaging 1.00
R6299:Cr2 UTSW 1 195168646 missense probably damaging 1.00
R6368:Cr2 UTSW 1 195168472 missense probably damaging 1.00
R6406:Cr2 UTSW 1 195169771 missense probably damaging 1.00
R6618:Cr2 UTSW 1 195157379 missense probably damaging 0.98
R6684:Cr2 UTSW 1 195171021 nonsense probably null
R6720:Cr2 UTSW 1 195155200 missense probably damaging 0.97
R6866:Cr2 UTSW 1 195151691 missense probably damaging 1.00
R6915:Cr2 UTSW 1 195171146 missense probably benign 0.06
R7057:Cr2 UTSW 1 195151610 missense possibly damaging 0.83
R7117:Cr2 UTSW 1 195160601 missense possibly damaging 0.79
R7200:Cr2 UTSW 1 195163249 missense probably damaging 1.00
R7209:Cr2 UTSW 1 195168724 missense probably damaging 1.00
R7414:Cr2 UTSW 1 195150036 missense probably benign
R7479:Cr2 UTSW 1 195158410 critical splice donor site probably null
R7480:Cr2 UTSW 1 195154176 missense probably damaging 1.00
X0028:Cr2 UTSW 1 195149982 missense probably benign 0.09
X0066:Cr2 UTSW 1 195166321 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCTTACCCTTTCTGATACAAG -3'
(R):5'- AAGCATGCTCTAGTTTCCAAACC -3'

Sequencing Primer
(F):5'- CAAGTTGGTACACCTGGTAACCATG -3'
(R):5'- GGCATGATGGCAAAGCACTTCC -3'
Posted On2019-09-13