Incidental Mutation 'R7352:Vps13c'
ID570665
Institutional Source Beutler Lab
Gene Symbol Vps13c
Ensembl Gene ENSMUSG00000035284
Gene Namevacuolar protein sorting 13C
SynonymsC230055H22Rik
Accession Numbers

Genbank: NM_177184; MGI: 2444207

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7352 (G1)
Quality Score173.646
Status Not validated
Chromosome9
Chromosomal Location67840396-67995638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67840446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 7 (V7A)
Ref Sequence ENSEMBL: ENSMUSP00000077040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077879] [ENSMUST00000217386]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077879
AA Change: V7A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077040
Gene: ENSMUSG00000035284
AA Change: V7A

DomainStartEndE-ValueType
Pfam:Chorein_N 3 117 1.3e-39 PFAM
low complexity region 151 165 N/A INTRINSIC
Pfam:VPS13 182 414 7.9e-70 PFAM
coiled coil region 422 443 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
Pfam:VPS13_mid_rpt 611 832 7.8e-71 PFAM
low complexity region 867 885 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
low complexity region 1112 1123 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1172 1369 2.1e-14 PFAM
low complexity region 1552 1573 N/A INTRINSIC
Pfam:VPS13_mid_rpt 1685 1883 2.8e-13 PFAM
Blast:INB 2128 2403 2e-48 BLAST
Pfam:SHR-BD 2759 3013 9.9e-32 PFAM
Pfam:VPS13_C 3317 3495 5.7e-65 PFAM
Pfam:ATG_C 3498 3588 7.9e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217386
AA Change: V7A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vacuolar protein sorting-associated 13 gene family. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 A T 5: 94,383,884 N209I probably damaging Het
Abca17 C T 17: 24,289,054 W1124* probably null Het
Acap3 G A 4: 155,905,711 V783I possibly damaging Het
Alkbh8 A G 9: 3,345,796 K172R probably damaging Het
Ankrd28 A G 14: 31,708,041 L860P probably damaging Het
Arap3 G A 18: 37,973,278 T1504I probably benign Het
Atad5 T C 11: 80,103,343 probably null Het
Atp8a2 A G 14: 59,791,204 V938A probably benign Het
AW551984 T C 9: 39,592,925 M582V probably benign Het
Axdnd1 C T 1: 156,382,477 V408I possibly damaging Het
Babam2 T A 5: 32,007,250 Y326* probably null Het
Baiap2l1 T C 5: 144,324,626 M20V probably benign Het
Bex6 A G 16: 32,186,216 probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Cad T A 5: 31,058,078 S78T probably damaging Het
Ccdc171 T A 4: 83,818,023 D1210E possibly damaging Het
Ccnd1 T C 7: 144,937,387 I161V possibly damaging Het
Cdc42bpb A T 12: 111,299,311 F1396I probably damaging Het
Cep170 A T 1: 176,769,857 D373E probably benign Het
Chrna4 A T 2: 181,037,474 I60N probably damaging Het
Cntn2 T C 1: 132,522,399 T586A probably benign Het
Csmd2 G T 4: 128,557,636 V3396F Het
Cyp3a44 T A 5: 145,803,688 L47F probably benign Het
D7Ertd443e A T 7: 134,349,394 H183Q probably benign Het
Ddx27 T C 2: 167,029,513 V510A probably benign Het
Ddx58 T A 4: 40,239,668 Q10L probably benign Het
Dgat1 G T 15: 76,502,824 C396* probably null Het
Dmpk A G 7: 19,086,072 S83G probably damaging Het
Dsc2 T G 18: 20,035,335 D689A probably benign Het
Eppk1 A T 15: 76,106,418 W2088R probably benign Het
Exph5 A C 9: 53,375,722 I1368L probably benign Het
Fadd T C 7: 144,580,659 K163R probably benign Het
Fam149a T A 8: 45,340,997 Q759L probably damaging Het
Foxo6 A T 4: 120,268,251 M449K probably benign Het
Gad1 T C 2: 70,594,750 F463L probably benign Het
Gad2 T A 2: 22,623,823 F91I probably benign Het
Gcc2 T C 10: 58,280,698 probably null Het
Gjc1 A C 11: 102,800,452 C242G probably damaging Het
Gkn1 T C 6: 87,348,118 E103G possibly damaging Het
Gm867 T C 10: 75,939,836 T39A probably benign Het
Gpr108 A G 17: 57,236,944 Y421H probably damaging Het
Gramd1b A C 9: 40,307,993 V508G probably damaging Het
Grm1 A T 10: 10,719,493 I797N probably damaging Het
Ice1 G A 13: 70,606,102 Q622* probably null Het
Kcnb2 T A 1: 15,710,611 V569E probably benign Het
Ksr2 T G 5: 117,689,641 I495S probably benign Het
Litaf A T 16: 10,963,353 M94K probably damaging Het
Lmod2 T C 6: 24,598,111 S77P possibly damaging Het
Lrp2 G T 2: 69,472,397 S2996Y probably benign Het
Ltf T C 9: 111,028,450 S436P probably benign Het
Map4k4 T A 1: 39,962,227 V58D unknown Het
Mapkapk3 C A 9: 107,257,070 D332Y possibly damaging Het
Mroh1 C A 15: 76,451,474 P1439Q probably benign Het
Ncor1 A G 11: 62,333,911 V841A probably damaging Het
Nrxn3 A G 12: 88,850,293 M248V probably benign Het
Olfr1000 T C 2: 85,608,784 N42S probably damaging Het
Olfr1208 T A 2: 88,896,718 N293I probably damaging Het
Olfr1238 T C 2: 89,406,462 M206V probably benign Het
Olfr1239 C A 2: 89,417,967 G149W probably damaging Het
Olfr1443 A G 19: 12,680,751 I214M possibly damaging Het
Olfr523 A T 7: 140,176,525 Y135F probably damaging Het
Olig2 A G 16: 91,226,689 D97G probably benign Het
Pcdha11 T A 18: 37,006,845 V509E probably damaging Het
Pglyrp3 G A 3: 92,014,640 W5* probably null Het
Phf14 A T 6: 11,961,638 N425Y probably damaging Het
Phf3 G T 1: 30,804,326 R1851S possibly damaging Het
Pigs A G 11: 78,328,812 T39A probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Pnma2 A G 14: 66,916,421 Q98R possibly damaging Het
Ppp4r3a G A 12: 101,041,832 T782I probably damaging Het
Prickle2 T G 6: 92,410,890 E566D probably benign Het
Pvr A G 7: 19,910,616 I331T possibly damaging Het
Ranbp3l A T 15: 8,968,358 probably benign Het
Rapgef4 T A 2: 72,180,091 I331N probably damaging Het
Reg3g C T 6: 78,466,859 W122* probably null Het
Rlbp1 A T 7: 79,381,680 I100N probably damaging Het
Rnf213 T A 11: 119,443,579 Y3206N Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Rtl6 G T 15: 84,556,980 R72S possibly damaging Het
Rufy3 T A 5: 88,637,194 D408E possibly damaging Het
Scn3a T C 2: 65,525,701 I230V possibly damaging Het
Slc23a4 A T 6: 34,948,279 I507N possibly damaging Het
Slc4a8 A G 15: 100,790,984 T392A probably damaging Het
Spaca7 T A 8: 12,585,742 I86K probably benign Het
Syt10 G T 15: 89,814,456 D228E probably benign Het
Tbx3 T A 5: 119,677,560 N308K probably benign Het
Telo2 A G 17: 25,102,069 V724A probably damaging Het
Tfip11 T C 5: 112,333,268 V370A probably benign Het
Thbs3 A G 3: 89,225,280 E843G probably benign Het
Tmprss11g T C 5: 86,496,542 I148V not run Het
Trbv14 T A 6: 41,135,495 D75E possibly damaging Het
Trio A G 15: 27,732,876 V2973A probably damaging Het
Ttn T C 2: 76,794,484 D15250G probably damaging Het
Ubr2 G A 17: 46,930,426 T1734I probably benign Het
Ush2a G T 1: 188,466,124 A1462S probably benign Het
Ushbp1 T G 8: 71,388,881 T435P possibly damaging Het
Wnk4 T C 11: 101,264,418 V385A probably damaging Het
Wnt2b C T 3: 104,947,177 V322I probably benign Het
Zbtb8a C T 4: 129,360,081 V207M probably benign Het
Zc3hav1l A G 6: 38,298,981 M87T probably benign Het
Other mutations in Vps13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vps13c APN 9 67945999 missense probably benign 0.20
IGL00336:Vps13c APN 9 67945942 missense probably benign 0.01
IGL00418:Vps13c APN 9 67876262 missense probably damaging 1.00
IGL00481:Vps13c APN 9 67860865 missense probably damaging 1.00
IGL00491:Vps13c APN 9 67893136 missense probably damaging 1.00
IGL00558:Vps13c APN 9 67937857 missense possibly damaging 0.52
IGL00811:Vps13c APN 9 67948181 missense probably damaging 0.99
IGL01011:Vps13c APN 9 67926955 missense probably damaging 0.98
IGL01094:Vps13c APN 9 67886284 missense probably damaging 1.00
IGL01330:Vps13c APN 9 67964108 missense probably damaging 1.00
IGL01402:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01404:Vps13c APN 9 67913204 critical splice acceptor site probably null
IGL01470:Vps13c APN 9 67912927 splice site probably benign
IGL01615:Vps13c APN 9 67955781 missense probably benign 0.01
IGL01694:Vps13c APN 9 67895349 missense probably damaging 1.00
IGL01752:Vps13c APN 9 67948228 missense probably damaging 1.00
IGL01810:Vps13c APN 9 67955780 missense probably benign
IGL01954:Vps13c APN 9 67969298 missense probably damaging 0.98
IGL01978:Vps13c APN 9 67930643 missense probably benign 0.03
IGL01998:Vps13c APN 9 67955068 splice site probably null
IGL02201:Vps13c APN 9 67967136 missense probably damaging 1.00
IGL02205:Vps13c APN 9 67883454 missense probably damaging 1.00
IGL02303:Vps13c APN 9 67945481 splice site probably benign
IGL02322:Vps13c APN 9 67937901 missense probably benign 0.02
IGL02456:Vps13c APN 9 67952976 missense probably damaging 1.00
IGL02474:Vps13c APN 9 67937876 missense probably benign 0.00
IGL02547:Vps13c APN 9 67908019 missense possibly damaging 0.83
IGL02640:Vps13c APN 9 67886248 splice site probably benign
IGL02673:Vps13c APN 9 67878098 missense probably damaging 1.00
IGL02721:Vps13c APN 9 67964149 splice site probably benign
IGL02834:Vps13c APN 9 67937855 missense probably benign
IGL02838:Vps13c APN 9 67975851 missense probably damaging 1.00
IGL03136:Vps13c APN 9 67950310 missense probably damaging 1.00
IGL03137:Vps13c APN 9 67890380 missense probably damaging 1.00
IGL03214:Vps13c APN 9 67897195 missense probably null 0.81
IGL03240:Vps13c APN 9 67955047 missense probably benign
IGL03303:Vps13c APN 9 67934504 missense probably benign 0.27
IGL03336:Vps13c APN 9 67951642 missense possibly damaging 0.76
IGL03366:Vps13c APN 9 67946026 missense probably benign 0.00
3-1:Vps13c UTSW 9 67936373 missense probably benign 0.00
IGL02991:Vps13c UTSW 9 67913877 missense probably damaging 1.00
PIT4802001:Vps13c UTSW 9 67937786 missense probably damaging 1.00
R0008:Vps13c UTSW 9 67919262 missense probably benign
R0206:Vps13c UTSW 9 67939162 splice site probably benign
R0288:Vps13c UTSW 9 67927366 missense probably damaging 0.99
R0324:Vps13c UTSW 9 67964309 missense possibly damaging 0.95
R0347:Vps13c UTSW 9 67910233 missense possibly damaging 0.93
R0374:Vps13c UTSW 9 67886246 splice site probably benign
R0388:Vps13c UTSW 9 67922915 splice site probably benign
R0409:Vps13c UTSW 9 67951644 missense probably benign 0.00
R0440:Vps13c UTSW 9 67972861 missense probably damaging 1.00
R0513:Vps13c UTSW 9 67930735 missense probably benign 0.02
R0520:Vps13c UTSW 9 67945851 missense possibly damaging 0.88
R0569:Vps13c UTSW 9 67973719 missense probably damaging 0.98
R0601:Vps13c UTSW 9 67927472 missense probably benign 0.12
R0659:Vps13c UTSW 9 67920935 missense probably benign 0.11
R0667:Vps13c UTSW 9 67951573 nonsense probably null
R0670:Vps13c UTSW 9 67925857 missense probably benign 0.35
R0698:Vps13c UTSW 9 67889723 missense probably benign 0.45
R0729:Vps13c UTSW 9 67961649 missense probably damaging 1.00
R0781:Vps13c UTSW 9 67972003 missense probably damaging 1.00
R0811:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0812:Vps13c UTSW 9 67934476 missense probably benign 0.06
R0839:Vps13c UTSW 9 67898738 missense probably benign
R1373:Vps13c UTSW 9 67927511 missense probably damaging 0.99
R1396:Vps13c UTSW 9 67955022 missense probably benign 0.00
R1499:Vps13c UTSW 9 67957505 missense probably benign 0.00
R1556:Vps13c UTSW 9 67930711 missense probably damaging 0.98
R1560:Vps13c UTSW 9 67936463 critical splice donor site probably null
R1584:Vps13c UTSW 9 67893112 missense possibly damaging 0.74
R1654:Vps13c UTSW 9 67951687 missense probably damaging 1.00
R1674:Vps13c UTSW 9 67853703 nonsense probably null
R1676:Vps13c UTSW 9 67926962 missense probably benign 0.20
R1695:Vps13c UTSW 9 67972075 nonsense probably null
R1710:Vps13c UTSW 9 67911529 missense probably benign 0.00
R1769:Vps13c UTSW 9 67965721 missense probably benign 0.00
R1775:Vps13c UTSW 9 67881447 missense probably damaging 1.00
R1795:Vps13c UTSW 9 67893985 nonsense probably null
R1799:Vps13c UTSW 9 67944117 missense probably damaging 0.98
R1835:Vps13c UTSW 9 67993013 missense probably benign 0.08
R1848:Vps13c UTSW 9 67936340 missense probably benign
R1903:Vps13c UTSW 9 67894052 missense probably damaging 1.00
R1944:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1945:Vps13c UTSW 9 67886276 missense probably damaging 1.00
R1951:Vps13c UTSW 9 67973759 critical splice donor site probably null
R1993:Vps13c UTSW 9 67975856 missense probably damaging 1.00
R2023:Vps13c UTSW 9 67936285 splice site probably benign
R2059:Vps13c UTSW 9 67860833 missense probably damaging 1.00
R2086:Vps13c UTSW 9 67950289 missense probably benign 0.29
R2120:Vps13c UTSW 9 67919334 missense possibly damaging 0.92
R2249:Vps13c UTSW 9 67988053 critical splice donor site probably null
R2257:Vps13c UTSW 9 67952946 missense possibly damaging 0.87
R2258:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2259:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2260:Vps13c UTSW 9 67953860 missense probably benign 0.01
R2265:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2266:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2269:Vps13c UTSW 9 67920947 missense possibly damaging 0.82
R2278:Vps13c UTSW 9 67939072 missense probably benign
R2306:Vps13c UTSW 9 67987993 missense probably damaging 0.99
R2327:Vps13c UTSW 9 67913820 missense probably damaging 0.98
R2349:Vps13c UTSW 9 67957526 missense possibly damaging 0.89
R2483:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3031:Vps13c UTSW 9 67923770 missense probably benign 0.00
R3623:Vps13c UTSW 9 67975907 critical splice donor site probably null
R3870:Vps13c UTSW 9 67884726 missense probably benign 0.00
R4173:Vps13c UTSW 9 67936313 missense probably benign 0.00
R4445:Vps13c UTSW 9 67982495 splice site probably null
R4491:Vps13c UTSW 9 67910193 missense probably benign
R4505:Vps13c UTSW 9 67939034 missense probably benign 0.02
R4574:Vps13c UTSW 9 67951683 missense probably damaging 1.00
R4691:Vps13c UTSW 9 67952935 missense possibly damaging 0.95
R4766:Vps13c UTSW 9 67878224 intron probably null
R4771:Vps13c UTSW 9 67929539 missense probably benign
R4801:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4802:Vps13c UTSW 9 67964282 missense probably damaging 1.00
R4962:Vps13c UTSW 9 67873891 missense probably damaging 1.00
R4995:Vps13c UTSW 9 67919321 missense probably benign 0.00
R5010:Vps13c UTSW 9 67916379 missense probably benign 0.19
R5183:Vps13c UTSW 9 67908052 missense probably damaging 1.00
R5226:Vps13c UTSW 9 67945553 missense probably benign 0.17
R5297:Vps13c UTSW 9 67878131 missense probably damaging 1.00
R5456:Vps13c UTSW 9 67927447 missense possibly damaging 0.53
R5494:Vps13c UTSW 9 67948146 missense probably benign 0.00
R5521:Vps13c UTSW 9 67951439 missense probably benign 0.08
R5524:Vps13c UTSW 9 67957556 missense probably damaging 1.00
R5685:Vps13c UTSW 9 67963173 missense possibly damaging 0.64
R5731:Vps13c UTSW 9 67895379 missense probably damaging 1.00
R5812:Vps13c UTSW 9 67982495 splice site probably benign
R5867:Vps13c UTSW 9 67982622 splice site probably null
R5893:Vps13c UTSW 9 67902839 critical splice acceptor site probably null
R5902:Vps13c UTSW 9 67934447 missense probably benign 0.00
R5957:Vps13c UTSW 9 67954971 missense probably damaging 1.00
R6076:Vps13c UTSW 9 67911602 missense probably damaging 1.00
R6187:Vps13c UTSW 9 67915657 missense probably damaging 1.00
R6268:Vps13c UTSW 9 67951449 missense probably benign 0.10
R6547:Vps13c UTSW 9 67973365 missense probably damaging 1.00
R6716:Vps13c UTSW 9 67951467 missense probably benign 0.00
R6837:Vps13c UTSW 9 67910222 missense probably benign
R6919:Vps13c UTSW 9 67927452 missense probably damaging 0.97
R7039:Vps13c UTSW 9 67937763 missense probably damaging 1.00
R7058:Vps13c UTSW 9 67923828 missense probably benign 0.39
R7082:Vps13c UTSW 9 67883453 missense probably damaging 1.00
R7195:Vps13c UTSW 9 67945825 missense possibly damaging 0.95
R7244:Vps13c UTSW 9 67889804 missense probably benign 0.00
R7300:Vps13c UTSW 9 67940544 missense probably benign 0.20
R7368:Vps13c UTSW 9 67914073 missense probably benign 0.23
R7411:Vps13c UTSW 9 67972001 missense probably damaging 0.98
U24488:Vps13c UTSW 9 67905916 missense probably benign 0.13
X0021:Vps13c UTSW 9 67937781 missense probably damaging 0.99
X0058:Vps13c UTSW 9 67927419 missense probably damaging 1.00
X0065:Vps13c UTSW 9 67873863 missense probably damaging 1.00
Z1088:Vps13c UTSW 9 67913975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGGGTCTTACTATGTATCTTTGGT -3'
(R):5'- ACATCGACAGCAGGGGCA -3'

Sequencing Primer
(F):5'- TCGAACACAGCTTTGTGCAG -3'
(R):5'- AAGCCCAGCGAGGTCAC -3'
Posted On2019-09-13