Incidental Mutation 'R0645:Dlc1'
ID57067
Institutional Source Beutler Lab
Gene Symbol Dlc1
Ensembl Gene ENSMUSG00000031523
Gene Namedeleted in liver cancer 1
SynonymsArhgap7, A730069N07Rik, STARD12, p122-RhoGAP
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0645 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location36567751-36953143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36574049 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1342 (D1342G)
Ref Sequence ENSEMBL: ENSMUSP00000132812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033923] [ENSMUST00000098826] [ENSMUST00000163663]
Predicted Effect probably benign
Transcript: ENSMUST00000033923
AA Change: D891G

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033923
Gene: ENSMUSG00000031523
AA Change: D891G

DomainStartEndE-ValueType
Pfam:SAM_2 15 76 2.2e-7 PFAM
low complexity region 154 174 N/A INTRINSIC
low complexity region 238 250 N/A INTRINSIC
low complexity region 298 325 N/A INTRINSIC
low complexity region 427 441 N/A INTRINSIC
RhoGAP 653 845 8.82e-59 SMART
START 887 1088 3.93e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098826
AA Change: D925G

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000096425
Gene: ENSMUSG00000031523
AA Change: D925G

DomainStartEndE-ValueType
Pfam:SAM_2 49 110 5.9e-8 PFAM
low complexity region 188 208 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 332 359 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
RhoGAP 687 879 8.82e-59 SMART
START 921 1122 3.93e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156312
Predicted Effect possibly damaging
Transcript: ENSMUST00000163663
AA Change: D1342G

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132812
Gene: ENSMUSG00000031523
AA Change: D1342G

DomainStartEndE-ValueType
low complexity region 353 369 N/A INTRINSIC
low complexity region 388 403 N/A INTRINSIC
Pfam:SAM_2 466 527 1.2e-7 PFAM
low complexity region 605 625 N/A INTRINSIC
low complexity region 689 701 N/A INTRINSIC
low complexity region 749 776 N/A INTRINSIC
low complexity region 878 892 N/A INTRINSIC
RhoGAP 1104 1296 8.82e-59 SMART
START 1338 1539 3.93e-59 SMART
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase-activating protein (GAP) that is a member of the rhoGAP family of proteins which play a role in the regulation of small GTP-binding proteins. GAP family proteins participate in signaling pathways that regulate cell processes involved in cytoskeletal changes. This gene functions as a tumor suppressor gene in a number of common cancers, including prostate, lung, colorectal, and breast cancers. Multiple transcript variants due to alternative promoters and alternative splicing have been found for this gene.[provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutants die by E10.5 with variable defects in the neural tube, heart, brain and placenta. Mouse embryonic fibroblasts homozygous for an activated conditional allele exhibti increased sensitivity to Ras-induced transformation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Dlc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Dlc1 APN 8 36570282 utr 3 prime probably benign
IGL00807:Dlc1 APN 8 36572848 missense probably benign 0.01
IGL00924:Dlc1 APN 8 36938214 missense probably benign
IGL01349:Dlc1 APN 8 36583824 missense probably damaging 0.96
IGL01419:Dlc1 APN 8 36850217 missense probably benign 0.02
IGL01871:Dlc1 APN 8 36850180 missense probably damaging 0.99
IGL01937:Dlc1 APN 8 36850191 missense probably benign 0.25
IGL02525:Dlc1 APN 8 36579646 missense probably damaging 1.00
IGL02696:Dlc1 APN 8 36574172 missense possibly damaging 0.65
IGL02826:Dlc1 APN 8 36570275 utr 3 prime probably benign
IGL03029:Dlc1 APN 8 36571262 splice site probably null
IGL02835:Dlc1 UTSW 8 36583901 missense probably damaging 1.00
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0068:Dlc1 UTSW 8 36937721 missense probably benign
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0164:Dlc1 UTSW 8 36599440 missense probably damaging 0.96
R0218:Dlc1 UTSW 8 36850229 missense probably benign
R0419:Dlc1 UTSW 8 36583586 missense possibly damaging 0.69
R0513:Dlc1 UTSW 8 36584010 missense probably damaging 1.00
R0646:Dlc1 UTSW 8 36858051 missense probably benign
R0727:Dlc1 UTSW 8 36572674 missense probably damaging 0.99
R0792:Dlc1 UTSW 8 36938548 missense probably benign 0.00
R1061:Dlc1 UTSW 8 36858051 missense probably benign
R1221:Dlc1 UTSW 8 36584831 missense probably benign
R1440:Dlc1 UTSW 8 36593463 splice site probably benign
R1501:Dlc1 UTSW 8 36938148 missense probably benign 0.06
R1606:Dlc1 UTSW 8 36850252 missense probably benign
R1707:Dlc1 UTSW 8 36937609 missense probably benign 0.03
R1750:Dlc1 UTSW 8 36858090 splice site probably null
R1762:Dlc1 UTSW 8 36937585 missense probably benign 0.25
R2041:Dlc1 UTSW 8 36582768 missense probably damaging 1.00
R2055:Dlc1 UTSW 8 36593381 missense probably damaging 0.98
R2091:Dlc1 UTSW 8 36937609 missense probably benign 0.00
R2987:Dlc1 UTSW 8 36574152 missense probably damaging 0.97
R4285:Dlc1 UTSW 8 36574128 missense possibly damaging 0.49
R4294:Dlc1 UTSW 8 36584753 missense possibly damaging 0.47
R4631:Dlc1 UTSW 8 36937558 critical splice donor site probably null
R4828:Dlc1 UTSW 8 36850246 missense possibly damaging 0.69
R4867:Dlc1 UTSW 8 36584645 missense probably benign 0.01
R4902:Dlc1 UTSW 8 36577131 missense probably damaging 1.00
R5067:Dlc1 UTSW 8 36584493 missense probably benign 0.04
R5068:Dlc1 UTSW 8 36938030 missense probably benign
R5198:Dlc1 UTSW 8 36938398 missense probably damaging 1.00
R5471:Dlc1 UTSW 8 36584725 missense probably benign 0.26
R5668:Dlc1 UTSW 8 36937501 unclassified probably benign
R5915:Dlc1 UTSW 8 36938675 utr 5 prime probably benign
R6323:Dlc1 UTSW 8 36938383 missense possibly damaging 0.62
R6655:Dlc1 UTSW 8 36572716 missense probably damaging 1.00
R6908:Dlc1 UTSW 8 36937687 missense probably benign 0.02
R6914:Dlc1 UTSW 8 36938210 missense probably benign
R6942:Dlc1 UTSW 8 36938210 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCTTCTTCCCAAGCAGACTGAGC -3'
(R):5'- TGACGGACCCATCTATCCTTGTGTG -3'

Sequencing Primer
(F):5'- AGGGGATCTTAATCACCTGGC -3'
(R):5'- GTTTCTCCCAGGTCCCTGAG -3'
Posted On2013-07-11