Incidental Mutation 'R0645:Cdt1'
ID57071
Institutional Source Beutler Lab
Gene Symbol Cdt1
Ensembl Gene ENSMUSG00000006585
Gene Namechromatin licensing and DNA replication factor 1
Synonyms2610318F11Rik, Ris2
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R0645 (G1)
Quality Score224
Status Validated
Chromosome8
Chromosomal Location122568015-122573554 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 122572145 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006760] [ENSMUST00000006764] [ENSMUST00000127664] [ENSMUST00000211823] [ENSMUST00000212093] [ENSMUST00000213029] [ENSMUST00000213062]
Predicted Effect probably benign
Transcript: ENSMUST00000006760
SMART Domains Protein: ENSMUSP00000006760
Gene: ENSMUSG00000006585

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
low complexity region 59 70 N/A INTRINSIC
low complexity region 72 108 N/A INTRINSIC
CDT1 199 362 3.68e-91 SMART
low complexity region 401 427 N/A INTRINSIC
Pfam:CDT1_C 431 525 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000006764
SMART Domains Protein: ENSMUSP00000006764
Gene: ENSMUSG00000006589

DomainStartEndE-ValueType
Pfam:Pribosyltran 28 178 2.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211810
Predicted Effect probably benign
Transcript: ENSMUST00000211823
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212053
Predicted Effect probably benign
Transcript: ENSMUST00000212093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213017
Predicted Effect probably benign
Transcript: ENSMUST00000213029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213030
Predicted Effect probably benign
Transcript: ENSMUST00000213062
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the formation of the pre-replication complex that is necessary for DNA replication. The encoded protein can bind geminin, which prevents replication and may function to prevent this protein from initiating replication at inappropriate origins. Phosphorylation of this protein by cyclin A-dependent kinases results in degradation of the protein. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a small in-frame deletion in exon 2 are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Nedd1 T C 10: 92,691,831 probably null Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Cdt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0014:Cdt1 UTSW 8 122572566 missense probably benign 0.00
R0494:Cdt1 UTSW 8 122572060 missense possibly damaging 0.64
R0614:Cdt1 UTSW 8 122568137 missense probably benign 0.04
R1699:Cdt1 UTSW 8 122569983 missense probably damaging 0.99
R1889:Cdt1 UTSW 8 122572052 missense possibly damaging 0.85
R3114:Cdt1 UTSW 8 122570482 nonsense probably null
R4243:Cdt1 UTSW 8 122571418 missense probably benign 0.04
R4532:Cdt1 UTSW 8 122571756 missense probably benign 0.00
R5496:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5498:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5501:Cdt1 UTSW 8 122570500 missense probably damaging 0.99
R5523:Cdt1 UTSW 8 122568093 missense possibly damaging 0.95
R5647:Cdt1 UTSW 8 122570208 missense possibly damaging 0.79
R6160:Cdt1 UTSW 8 122571368 missense probably benign 0.36
R6892:Cdt1 UTSW 8 122570212 missense probably damaging 1.00
R7001:Cdt1 UTSW 8 122572510 missense probably damaging 1.00
R7089:Cdt1 UTSW 8 122571980 missense probably damaging 1.00
R7214:Cdt1 UTSW 8 122568273 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGACCATTGGCTGCTGACCCATC -3'
(R):5'- GGCCTTTGTCAAGGCTTATCCACTG -3'

Sequencing Primer
(F):5'- TCCCCATGCAGATAAGGGC -3'
(R):5'- AGGCTTATCCACTGCTATGTACAG -3'
Posted On2013-07-11