Incidental Mutation 'R7353:Emilin3'
ID570716
Institutional Source Beutler Lab
Gene Symbol Emilin3
Ensembl Gene ENSMUSG00000050700
Gene Nameelastin microfibril interfacer 3
SynonymsEmilin5, EMILIN-T
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7353 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location160906437-160912328 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 160908821 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 336 (E336V)
Ref Sequence ENSEMBL: ENSMUSP00000059732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456] [ENSMUST00000109457]
Predicted Effect probably benign
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057169
AA Change: E336V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700
AA Change: E336V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109454
AA Change: E289V

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700
AA Change: E289V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109457
SMART Domains Protein: ENSMUSP00000105083
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 110 4.1e-48 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
Pfam:Lipin_mid 435 538 9.5e-35 PFAM
low complexity region 569 579 N/A INTRINSIC
LNS2 647 803 1.4e-105 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.9%
  • 20x: 99.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik C A 13: 119,488,178 A11S unknown Het
Aadacl4 G A 4: 144,617,920 V89I probably damaging Het
Abcc9 T A 6: 142,601,005 I1369F probably damaging Het
Adgrf3 T A 5: 30,198,497 I427F probably damaging Het
Alox12e T C 11: 70,321,435 Y139C probably damaging Het
Arhgef2 T A 3: 88,635,686 V397E possibly damaging Het
Arhgef28 T A 13: 98,075,202 Y91F probably damaging Het
Bcar3 A G 3: 122,512,692 T454A probably benign Het
Bicc1 G T 10: 70,947,900 T469K probably benign Het
Boc C T 16: 44,485,737 V1070M unknown Het
Ccdc88a T A 11: 29,463,368 N635K probably benign Het
Ccr2 T C 9: 124,106,756 S358P probably damaging Het
Ccser2 T C 14: 36,941,143 Q28R possibly damaging Het
Cenpf T A 1: 189,654,138 K1982* probably null Het
Csn1s2a A T 5: 87,785,302 I137F possibly damaging Het
Cttnbp2 A T 6: 18,375,944 I1532K possibly damaging Het
Dnajc13 C A 9: 104,230,031 R304L possibly damaging Het
Dopey1 T A 9: 86,512,859 M664K probably damaging Het
Eml5 A G 12: 98,825,424 Y63H Het
Fbxo41 G T 6: 85,479,976 R404S possibly damaging Het
Gm8897 G A 5: 11,416,436 D7N possibly damaging Het
Gpr155 A T 2: 73,367,491 Y456* probably null Het
Gpr156 T A 16: 37,992,161 N286K probably damaging Het
Kcna5 A G 6: 126,534,845 S107P probably benign Het
Kcne2 A T 16: 92,296,822 H79L possibly damaging Het
Kcnh4 T A 11: 100,757,199 M113L probably benign Het
Lad1 T A 1: 135,827,775 L263Q probably damaging Het
Lctl G A 9: 64,126,967 G296D probably damaging Het
Lmtk3 A T 7: 45,788,000 I205F possibly damaging Het
Magel2 G T 7: 62,379,331 R661L unknown Het
Mcm10 G A 2: 5,007,109 P180S possibly damaging Het
Mia3 G T 1: 183,327,392 A446D Het
N4bp2 G A 5: 65,806,371 V588M probably benign Het
Naip6 C T 13: 100,299,751 V755M probably benign Het
Neurl1a T C 19: 47,240,660 V213A probably damaging Het
Nrd1 A G 4: 109,039,749 T522A probably damaging Het
Ntng1 T C 3: 110,135,447 Q21R probably damaging Het
Nup160 T C 2: 90,703,952 L707S probably damaging Het
Oas2 A T 5: 120,738,522 V452D probably damaging Het
Olfr3 A G 2: 36,812,903 L63P probably damaging Het
Olfr350 A T 2: 36,850,069 M8L probably benign Het
Olfr351 G A 2: 36,859,668 R227* probably null Het
Olfr519 A G 7: 108,894,222 F67L probably damaging Het
Olfr593 A C 7: 103,212,309 T150P probably damaging Het
Plekhg1 A T 10: 3,964,327 T1405S Het
Pnrc1 G A 4: 33,248,300 P33L probably damaging Het
Prkag2 A T 5: 24,880,686 V312E possibly damaging Het
Rps17 T A 7: 81,344,345 E76V possibly damaging Het
Rsph10b G A 5: 143,967,220 G672S possibly damaging Het
Slc2a13 T C 15: 91,321,604 N460S probably benign Het
Slco2b1 A T 7: 99,690,557 C56S possibly damaging Het
Spn T C 7: 127,137,006 T110A probably benign Het
Sult2a8 T C 7: 14,413,715 N217S possibly damaging Het
Tbx2 C A 11: 85,833,489 T128N probably damaging Het
Tecpr2 A T 12: 110,967,844 M1313L probably benign Het
Tmc2 G A 2: 130,196,577 probably null Het
Tstd1 G T 1: 171,419,955 A69S probably damaging Het
Txnrd3 A G 6: 89,661,585 D252G probably benign Het
Ulk2 T C 11: 61,819,348 N345D probably damaging Het
Unc13c T C 9: 73,574,073 D1694G probably benign Het
Vill T C 9: 119,065,493 V406A probably damaging Het
Vmn2r115 T C 17: 23,345,913 V258A possibly damaging Het
Vmn2r82 T A 10: 79,396,618 M817K probably benign Het
Xpnpep3 T C 15: 81,430,887 S263P probably benign Het
Zfp980 A G 4: 145,702,144 D481G probably benign Het
Zmpste24 A G 4: 121,095,581 S81P probably damaging Het
Znrf4 A G 17: 56,512,169 V46A probably benign Het
Other mutations in Emilin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Emilin3 APN 2 160909783 missense probably damaging 1.00
IGL02231:Emilin3 APN 2 160908515 missense probably damaging 1.00
IGL02812:Emilin3 APN 2 160908729 nonsense probably null
IGL02813:Emilin3 APN 2 160908729 nonsense probably null
IGL02892:Emilin3 APN 2 160909149 missense possibly damaging 0.72
IGL03012:Emilin3 APN 2 160908729 nonsense probably null
IGL03017:Emilin3 APN 2 160908729 nonsense probably null
IGL03083:Emilin3 APN 2 160908729 nonsense probably null
IGL03094:Emilin3 APN 2 160908729 nonsense probably null
IGL03163:Emilin3 APN 2 160908729 nonsense probably null
IGL03206:Emilin3 APN 2 160910799 missense probably damaging 1.00
IGL02835:Emilin3 UTSW 2 160908729 nonsense probably null
IGL03046:Emilin3 UTSW 2 160908729 nonsense probably null
PIT1430001:Emilin3 UTSW 2 160908482 missense possibly damaging 0.48
R0373:Emilin3 UTSW 2 160909817 missense probably benign 0.00
R0392:Emilin3 UTSW 2 160910879 unclassified probably benign
R0420:Emilin3 UTSW 2 160910879 unclassified probably benign
R0627:Emilin3 UTSW 2 160908176 missense probably damaging 1.00
R0628:Emilin3 UTSW 2 160910879 unclassified probably benign
R0671:Emilin3 UTSW 2 160908329 missense probably damaging 1.00
R1655:Emilin3 UTSW 2 160910866 critical splice acceptor site probably null
R2016:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R2017:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R3624:Emilin3 UTSW 2 160908257 missense possibly damaging 0.59
R4062:Emilin3 UTSW 2 160907796 missense probably benign
R4307:Emilin3 UTSW 2 160908317 missense probably damaging 1.00
R4365:Emilin3 UTSW 2 160908486 missense probably benign
R4669:Emilin3 UTSW 2 160910797 missense probably benign 0.00
R5076:Emilin3 UTSW 2 160909318 critical splice acceptor site probably null
R5227:Emilin3 UTSW 2 160909265 missense probably damaging 1.00
R5725:Emilin3 UTSW 2 160908490 nonsense probably null
R5914:Emilin3 UTSW 2 160909070 missense probably damaging 1.00
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6919:Emilin3 UTSW 2 160908098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTTCCTCTCAAGGCTGTC -3'
(R):5'- CAGCTGTTAGATGAGGTGCG -3'

Sequencing Primer
(F):5'- TCTCAAGGCTGTCCACCCG -3'
(R):5'- CTCACCTGCAGCGGCTC -3'
Posted On2019-09-13