Incidental Mutation 'R7354:Slc22a15'
ID570786
Institutional Source Beutler Lab
Gene Symbol Slc22a15
Ensembl Gene ENSMUSG00000033147
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 15
SynonymsA530052I06Rik, 2610034P21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R7354 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location101855776-101924453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101864581 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 401 (H401Y)
Ref Sequence ENSEMBL: ENSMUSP00000102541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106928] [ENSMUST00000183255] [ENSMUST00000190824]
Predicted Effect probably benign
Transcript: ENSMUST00000106928
AA Change: H401Y

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102541
Gene: ENSMUSG00000033147
AA Change: H401Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 58 495 6.9e-29 PFAM
Pfam:MFS_1 69 450 3.4e-24 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183255
SMART Domains Protein: ENSMUSP00000138357
Gene: ENSMUSG00000033147

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 56 244 5.2e-13 PFAM
Pfam:MFS_1 69 244 7.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190824
AA Change: H246Y

PolyPhen 2 Score 0.335 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139518
Gene: ENSMUSG00000033147
AA Change: H246Y

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Sugar_tr 88 341 3.3e-5 PFAM
low complexity region 369 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Organic ion transporters, such as SLC22A15, transport various medically and physiologically important compounds, including pharmaceuticals, toxins, hormones, neurotransmitters, and cellular metabolites. These transporters are also referred to as amphiphilic solute facilitators (ASFs).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik A T 13: 59,741,834 L724* probably null Het
5430419D17Rik G A 7: 131,256,729 C1042Y possibly damaging Het
5430419D17Rik G T 7: 131,272,033 C1696F unknown Het
Ago3 T A 4: 126,417,306 Q38L possibly damaging Het
Apon T A 10: 128,254,738 I95N probably benign Het
Arid1a G T 4: 133,693,947 P464Q unknown Het
Arid4b A G 13: 14,164,870 D503G probably benign Het
Asxl2 T C 12: 3,455,637 probably benign Het
Atp2a1 A T 7: 126,448,856 V594D probably damaging Het
Begain A G 12: 109,033,289 F519L possibly damaging Het
Bora A G 14: 99,047,358 T15A probably damaging Het
Btbd7 A T 12: 102,838,205 M192K probably benign Het
Ccdc125 T G 13: 100,677,874 probably null Het
Cfap74 G T 4: 155,465,347 V146L unknown Het
Crisp1 G A 17: 40,319,180 probably benign Het
Ctbp1 A T 5: 33,250,388 H292Q possibly damaging Het
Defb5 T A 8: 19,250,734 M34K probably benign Het
Dnajc27 A G 12: 4,096,249 I93V probably benign Het
Dqx1 T A 6: 83,060,976 Y448* probably null Het
Dynap A T 18: 70,241,300 C52S possibly damaging Het
Ehd4 C A 2: 120,102,132 R271L probably damaging Het
Ercc2 T G 7: 19,393,654 I619S possibly damaging Het
Etf1 A G 18: 34,905,987 I409T probably damaging Het
Fam117a A G 11: 95,380,703 D367G probably damaging Het
Fancd2 A G 6: 113,595,946 D1447G unknown Het
Fbxw9 T C 8: 85,062,196 S192P probably damaging Het
Frzb A T 2: 80,446,809 L11Q probably damaging Het
Gm14496 T C 2: 182,000,686 S717P probably damaging Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gm4353 C T 7: 116,083,911 R145Q probably benign Het
Gm765 T A 6: 98,238,281 D127V probably damaging Het
Gpr12 A T 5: 146,583,962 V50D probably damaging Het
Hes1 T C 16: 30,065,928 probably null Het
Hmcn1 A T 1: 150,806,445 C451* probably null Het
Iars T C 13: 49,704,320 V347A probably benign Het
Igfn1 A G 1: 135,976,032 S323P possibly damaging Het
Itga6 G A 2: 71,820,230 A207T probably damaging Het
Lgi4 T A 7: 31,060,622 L81H probably damaging Het
Lrp1 T C 10: 127,571,408 E1888G probably damaging Het
Man2a1 C T 17: 64,752,544 T1142M probably damaging Het
Mgam A T 6: 40,744,798 Y350F probably damaging Het
Miga1 T C 3: 152,290,500 D351G probably damaging Het
Mro A G 18: 73,873,314 T111A probably benign Het
Mtrr A T 13: 68,566,207 V471E probably damaging Het
Myh3 C A 11: 67,096,882 L1394I probably damaging Het
Myocd A G 11: 65,187,493 V492A probably benign Het
Nbeal2 A G 9: 110,629,179 F2115S probably damaging Het
Nlrp1b A T 11: 71,181,550 M489K possibly damaging Het
Olfr1228 T C 2: 89,248,687 probably null Het
Olfr128 A G 17: 37,924,393 I276V probably benign Het
Olfr1294 C T 2: 111,537,564 A242T possibly damaging Het
Olfr376 A T 11: 73,375,375 I212F probably benign Het
Olfr536 A C 7: 140,504,186 I91R probably damaging Het
Orc2 A G 1: 58,469,747 S462P possibly damaging Het
Pcdh9 T C 14: 93,888,270 T155A probably benign Het
Pcdhb16 G A 18: 37,478,124 V46I possibly damaging Het
Pcdhb22 A G 18: 37,520,258 D336G probably damaging Het
Pde4dip T A 3: 97,719,330 R1297S probably damaging Het
Plin4 A G 17: 56,104,427 M868T probably benign Het
Plxnb2 A G 15: 89,165,725 M531T possibly damaging Het
Poc5 T C 13: 96,394,525 V77A probably benign Het
Recql5 G A 11: 115,928,201 R180C probably damaging Het
Rho C A 6: 115,935,503 Y268* probably null Het
Riok1 A T 13: 38,047,312 H182L probably benign Het
Rnf207 T C 4: 152,314,091 D273G probably damaging Het
Serpinb11 A G 1: 107,377,533 Y213C probably benign Het
Slc16a10 T C 10: 40,076,955 Y181C probably damaging Het
Slc5a5 C A 8: 70,889,603 R268L probably damaging Het
Slc9a8 T C 2: 167,474,131 F576S possibly damaging Het
Slx4 T C 16: 3,987,099 E617G probably benign Het
Top1 T C 2: 160,704,958 I386T probably damaging Het
Tor1aip1 G T 1: 156,036,113 D41E probably damaging Het
Tsc22d4 G A 5: 137,768,109 R479Q probably benign Het
Unc79 C T 12: 103,142,702 T2191I possibly damaging Het
Vmn2r109 A T 17: 20,540,781 D771E probably damaging Het
Vmn2r82 A C 10: 79,356,630 M14L probably benign Het
Zc3h7a C T 16: 11,148,514 S583N probably damaging Het
Zfp518b G A 5: 38,682,779 probably benign Het
Zswim4 A G 8: 84,228,849 W314R probably damaging Het
Other mutations in Slc22a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Slc22a15 APN 3 101860820 missense probably benign 0.00
IGL01120:Slc22a15 APN 3 101897166 missense probably damaging 1.00
IGL01345:Slc22a15 APN 3 101880176 missense probably benign 0.00
IGL01871:Slc22a15 APN 3 101860794 splice site probably benign
IGL01880:Slc22a15 APN 3 101860848 missense probably benign 0.32
R0310:Slc22a15 UTSW 3 101860511 missense probably benign 0.12
R1758:Slc22a15 UTSW 3 101860453 nonsense probably null
R1937:Slc22a15 UTSW 3 101880189 critical splice acceptor site probably null
R3804:Slc22a15 UTSW 3 101897274 missense probably damaging 1.00
R4830:Slc22a15 UTSW 3 101875603 intron probably benign
R5564:Slc22a15 UTSW 3 101864589 missense probably benign 0.34
R5684:Slc22a15 UTSW 3 101862955 missense probably damaging 1.00
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6114:Slc22a15 UTSW 3 101860852 nonsense probably null
R6481:Slc22a15 UTSW 3 101883583 missense possibly damaging 0.88
R6641:Slc22a15 UTSW 3 101875706 missense possibly damaging 0.52
R6945:Slc22a15 UTSW 3 101924114 missense probably damaging 0.99
R7373:Slc22a15 UTSW 3 101877897 missense possibly damaging 0.78
R7431:Slc22a15 UTSW 3 101897940 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCATCTCTGTCCACGAAAGC -3'
(R):5'- CCACACAGGATAGTCAGCTG -3'

Sequencing Primer
(F):5'- TCTGTCCACGAAAGCACAGTTAAC -3'
(R):5'- GACTGTGAAACTGGAATGCTTTTAC -3'
Posted On2019-09-13