Incidental Mutation 'R0645:Nedd1'
ID57083
Institutional Source Beutler Lab
Gene Symbol Nedd1
Ensembl Gene ENSMUSG00000019988
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 1
Synonyms
MMRRC Submission 038830-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0645 (G1)
Quality Score163
Status Validated
Chromosome10
Chromosomal Location92684746-92722420 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 92691831 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020163]
Predicted Effect probably null
Transcript: ENSMUST00000020163
SMART Domains Protein: ENSMUSP00000020163
Gene: ENSMUSG00000019988

DomainStartEndE-ValueType
WD40 21 63 5.97e-1 SMART
WD40 67 105 9.75e-3 SMART
WD40 108 147 6.19e-5 SMART
WD40 149 191 6.42e-1 SMART
WD40 194 235 9.1e-3 SMART
WD40 238 276 2.24e-2 SMART
low complexity region 555 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214417
Meta Mutation Damage Score 0.5972 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 99% (94/95)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik C T 2: 111,214,583 probably null Het
Adam18 G T 8: 24,672,120 Y46* probably null Het
Adam26b A C 8: 43,520,487 C493G probably damaging Het
Ak5 A T 3: 152,653,615 L182Q probably damaging Het
Akt1s1 T C 7: 44,849,221 probably benign Het
Amhr2 G T 15: 102,446,428 G133C probably damaging Het
Btbd9 A T 17: 30,524,967 L187Q probably damaging Het
Ccdc117 A T 11: 5,534,385 probably benign Het
Ccdc138 A T 10: 58,575,720 I637F probably damaging Het
Ccdc162 A G 10: 41,586,411 probably benign Het
Cdc25b C A 2: 131,191,613 H157Q probably benign Het
Cdon A G 9: 35,477,083 probably null Het
Cdt1 G A 8: 122,572,145 probably benign Het
Cep350 C T 1: 155,940,712 probably null Het
Cfb T C 17: 34,860,016 K831R probably benign Het
Cldn4 C A 5: 134,946,791 probably benign Het
Cntnap5b T C 1: 100,072,042 probably benign Het
Cyp27b1 T G 10: 127,049,098 S77A probably benign Het
Dlc1 T C 8: 36,574,049 D1342G possibly damaging Het
Dlgap4 A G 2: 156,761,879 H887R probably damaging Het
Duox2 A G 2: 122,292,658 I503T probably damaging Het
Elmsan1 G T 12: 84,158,303 N834K possibly damaging Het
Eml4 T C 17: 83,463,493 probably benign Het
Ermap A G 4: 119,185,691 S212P probably benign Het
Esrrg T A 1: 188,043,341 C22S probably benign Het
Evx2 T A 2: 74,657,894 Y194F possibly damaging Het
Fam126a C T 5: 23,979,508 G242D probably damaging Het
Fbn2 T G 18: 58,058,389 D1554A probably damaging Het
Flrt1 G A 19: 7,097,143 probably benign Het
Fndc5 A G 4: 129,139,837 probably benign Het
Frem1 A T 4: 82,989,166 I837N probably damaging Het
Fzd10 G T 5: 128,602,598 A461S possibly damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gbp7 A G 3: 142,538,165 probably null Het
Gm10639 T C 9: 78,299,021 I75T possibly damaging Het
Gm5919 T A 9: 83,883,383 C91S unknown Het
Gm597 T A 1: 28,776,930 N674Y probably damaging Het
Gpr31b A T 17: 13,052,206 C25* probably null Het
Grb10 A G 11: 11,936,755 S505P probably damaging Het
Grm4 A T 17: 27,435,209 V542E probably damaging Het
Hivep3 G A 4: 120,097,334 R949H possibly damaging Het
Invs A T 4: 48,407,653 M543L probably benign Het
Kcnk2 T C 1: 189,256,730 probably null Het
Kdm6b A T 11: 69,405,018 S808T unknown Het
Klhl30 C T 1: 91,355,506 R277W probably damaging Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
Lingo3 G T 10: 80,835,335 H254N probably benign Het
Lzts1 A T 8: 69,135,740 H521Q possibly damaging Het
Map3k19 A C 1: 127,822,182 I1144S possibly damaging Het
Mast2 A G 4: 116,307,987 S1411P probably damaging Het
Mast2 T C 4: 116,312,846 probably benign Het
Mesp1 G T 7: 79,792,580 S225R possibly damaging Het
Micu1 A G 10: 59,839,681 T366A possibly damaging Het
Mknk2 T C 10: 80,671,908 probably null Het
Msh5 A G 17: 35,039,223 L309P probably damaging Het
Myo7b T C 18: 31,994,909 I577V probably benign Het
Myom2 T A 8: 15,117,698 D1094E probably damaging Het
Neu4 T C 1: 94,022,469 L50S probably damaging Het
Noa1 T C 5: 77,309,875 Y61C probably benign Het
Nr1h4 A T 10: 89,506,528 M30K probably benign Het
Nsd3 A G 8: 25,709,069 I1219V probably benign Het
Nup188 T A 2: 30,343,466 probably null Het
Olfr1039 A G 2: 86,131,034 S210P probably damaging Het
Olfr1123 T A 2: 87,418,268 Y71* probably null Het
Olfr420 A T 1: 174,159,354 T194S probably benign Het
Olfr784 T A 10: 129,388,293 I220N possibly damaging Het
Pbk G A 14: 65,813,796 probably benign Het
Pcnx2 G A 8: 125,760,720 T1848M possibly damaging Het
Pdzd7 C T 19: 45,045,475 G57R possibly damaging Het
Pik3r4 C A 9: 105,669,187 probably benign Het
Plce1 A G 19: 38,777,989 S2153G probably damaging Het
Pphln1 G A 15: 93,420,311 V34M possibly damaging Het
Prrc2a T C 17: 35,156,332 D1114G probably damaging Het
Prss16 T C 13: 22,009,376 probably benign Het
Rtp3 T C 9: 110,987,100 K128E probably damaging Het
Scn3a T A 2: 65,524,850 I241F possibly damaging Het
Setd1a G A 7: 127,787,210 V336I probably damaging Het
Sfpq A G 4: 127,022,969 I320V possibly damaging Het
Skint5 A T 4: 113,763,482 D678E unknown Het
Slc12a9 G A 5: 137,315,376 P774S probably benign Het
Slc25a54 C G 3: 109,112,165 L362V possibly damaging Het
Smarcd1 A G 15: 99,707,386 probably null Het
Suco A T 1: 161,834,114 M916K probably damaging Het
Tiam2 T C 17: 3,514,698 S1404P possibly damaging Het
Topors T C 4: 40,260,333 T984A unknown Het
Trabd2b A T 4: 114,586,570 K308M probably damaging Het
Trmo A T 4: 46,377,083 probably benign Het
Trpc3 A T 3: 36,671,505 D107E probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uggt2 A C 14: 119,057,598 Y539D probably benign Het
Wwc2 T G 8: 47,900,639 probably benign Het
Zdbf2 T A 1: 63,304,950 D829E possibly damaging Het
Other mutations in Nedd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Nedd1 APN 10 92694974 splice site probably benign
IGL00988:Nedd1 APN 10 92689686 missense possibly damaging 0.71
IGL01563:Nedd1 APN 10 92698169 critical splice donor site probably null
IGL01588:Nedd1 APN 10 92686262 missense probably benign 0.12
IGL01988:Nedd1 APN 10 92714159 missense probably benign 0.39
IGL02706:Nedd1 APN 10 92686285 missense possibly damaging 0.88
IGL02938:Nedd1 APN 10 92689657 nonsense probably null
IGL03011:Nedd1 APN 10 92689641 missense possibly damaging 0.92
R0125:Nedd1 UTSW 10 92691929 missense possibly damaging 0.93
R0173:Nedd1 UTSW 10 92698883 missense probably benign 0.30
R0244:Nedd1 UTSW 10 92716265 intron probably benign
R0791:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1490:Nedd1 UTSW 10 92700798 missense probably damaging 1.00
R1522:Nedd1 UTSW 10 92719614 missense probably damaging 1.00
R1797:Nedd1 UTSW 10 92698739 missense possibly damaging 0.46
R1984:Nedd1 UTSW 10 92714160 missense possibly damaging 0.63
R2474:Nedd1 UTSW 10 92719603 missense probably damaging 0.99
R2877:Nedd1 UTSW 10 92714126 missense possibly damaging 0.89
R2883:Nedd1 UTSW 10 92694998 missense probably damaging 0.98
R4694:Nedd1 UTSW 10 92719582 missense probably benign 0.00
R4798:Nedd1 UTSW 10 92698910 missense probably benign 0.00
R4830:Nedd1 UTSW 10 92686258 missense probably damaging 1.00
R4963:Nedd1 UTSW 10 92695031 missense probably damaging 1.00
R5174:Nedd1 UTSW 10 92711212 missense possibly damaging 0.77
R5329:Nedd1 UTSW 10 92686240 missense probably damaging 1.00
R5404:Nedd1 UTSW 10 92716192 missense probably benign 0.04
R5534:Nedd1 UTSW 10 92695032 missense probably benign 0.01
R6045:Nedd1 UTSW 10 92695100 nonsense probably null
R6154:Nedd1 UTSW 10 92698242 missense possibly damaging 0.65
R6512:Nedd1 UTSW 10 92691875 missense probably benign
R6692:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6693:Nedd1 UTSW 10 92698337 missense possibly damaging 0.88
R6943:Nedd1 UTSW 10 92711306 missense probably damaging 1.00
R7011:Nedd1 UTSW 10 92690773 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGGCTCCAGAAGTGTTCTTCAGTG -3'
(R):5'- CCAGTGTTTAGGGTTGGGAGACATC -3'

Sequencing Primer
(F):5'- GTGTTCTTCAGTGATTAAAAACTGGC -3'
(R):5'- TTGGGAGACATCTTAAGCATATGGC -3'
Posted On2013-07-11