Incidental Mutation 'R7361:Il12rb2'
ID571331
Institutional Source Beutler Lab
Gene Symbol Il12rb2
Ensembl Gene ENSMUSG00000018341
Gene Nameinterleukin 12 receptor, beta 2
SynonymsIL-12RB2, Ifnm, A930027I18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7361 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location67291318-67376188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67303466 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 586 (L586I)
Ref Sequence ENSEMBL: ENSMUSP00000010605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018485] [ENSMUST00000117441]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018485
AA Change: L586I

PolyPhen 2 Score 0.482 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000010605
Gene: ENSMUSG00000018341
AA Change: L586I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Lep_receptor_Ig 28 120 6.4e-20 PFAM
FN3 137 225 2.41e0 SMART
FN3 240 320 3.4e-4 SMART
Blast:FN3 340 434 2e-40 BLAST
FN3 436 525 3.17e-4 SMART
FN3 534 622 6.45e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117441
AA Change: L252I

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113267
Gene: ENSMUSG00000018341
AA Change: L252I

DomainStartEndE-ValueType
Blast:FN3 6 100 1e-41 BLAST
FN3 102 191 3.17e-4 SMART
FN3 200 288 6.45e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I transmembrane protein identified as a subunit of the interleukin 12 receptor complex. The coexpression of this and IL12RB1 proteins was shown to lead to the formation of high-affinity IL12 binding sites and reconstitution of IL12 dependent signaling. The expression of this gene is up-regulated by interferon gamma in Th1 cells, and plays a role in Th1 cell differentiation. The up-regulation of this gene is found to be associated with a number of infectious diseases, such as Crohn's disease and leprosy, which is thought to contribute to the inflammatory response and host defense. Several transcript variants encoding different isoforms and non-protein coding transcripts have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele have defects in IFN-gamma production and cytotoxic T lymphocyte and NK cytotoxicity, develop an autoimmune/lymphoproliferative disorder associated with higher susceptibility to spontaneous tumor formation, but show reduced in vivo growth of B16 melanoma tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630073D07Rik C T 6: 132,627,471 V4I unknown Het
Actn1 A T 12: 80,193,715 D199E probably benign Het
Adam17 T C 12: 21,325,601 D739G probably damaging Het
Agmat T C 4: 141,746,852 S15P probably benign Het
Ahsa2 A G 11: 23,491,099 S229P probably damaging Het
Arhgef3 A G 14: 27,265,578 D36G possibly damaging Het
BC055324 A T 1: 163,986,033 D207E possibly damaging Het
C6 C A 15: 4,796,922 Y662* probably null Het
Ccs T C 19: 4,833,350 D140G probably benign Het
Cdc42bpb A G 12: 111,345,605 L65P probably damaging Het
Cdh24 A T 14: 54,638,921 V149E possibly damaging Het
Cdk12 C A 11: 98,210,468 S384* probably null Het
Cep350 G A 1: 155,901,491 A1701V probably damaging Het
Ces1g T C 8: 93,333,679 Q104R not run Het
Chd5 A G 4: 152,363,288 H537R probably damaging Het
Cln5 T A 14: 103,075,903 V197D probably damaging Het
Coq7 A G 7: 118,529,575 V79A probably benign Het
Cp A T 3: 19,964,306 N58I probably benign Het
Cplx2 A T 13: 54,378,826 M16L probably benign Het
Crot A G 5: 8,977,534 L266S probably damaging Het
Ctbs T A 3: 146,458,754 Y221N probably damaging Het
Cul7 T A 17: 46,657,007 L707Q probably damaging Het
D430041D05Rik G A 2: 104,255,018 T378I possibly damaging Het
Dixdc1 T C 9: 50,688,653 I364V probably damaging Het
Dnah11 T A 12: 118,018,742 H2564L probably damaging Het
Dnajc3 T C 14: 118,938,164 Y26H probably benign Het
Dpysl2 G A 14: 66,834,215 H159Y possibly damaging Het
Ehmt1 T A 2: 24,856,701 K423I possibly damaging Het
Enpp7 A G 11: 118,992,159 N353S probably benign Het
Ext1 G A 15: 53,344,723 A214V probably damaging Het
Fbxo18 A T 2: 11,747,076 I937N probably damaging Het
Fbxo39 T C 11: 72,316,974 Y51H possibly damaging Het
Fry A G 5: 150,436,847 H1986R possibly damaging Het
Gm2022 A G 12: 87,895,400 N11D unknown Het
Grem2 T C 1: 174,836,948 K112E probably benign Het
Gucy1a1 A G 3: 82,097,720 V586A probably damaging Het
Il18 T C 9: 50,579,314 I83T probably damaging Het
Irs1 A T 1: 82,289,114 Y460* probably null Het
Jak1 G T 4: 101,184,339 Q161K possibly damaging Het
Jakmip1 T A 5: 37,118,804 L486Q probably damaging Het
Jmjd1c C A 10: 67,218,364 Q16K probably benign Het
Kidins220 T C 12: 25,057,000 L1393P probably benign Het
Klhl24 A C 16: 20,118,000 I453L probably benign Het
Krtap2-4 C T 11: 99,614,594 D64N probably damaging Het
Man1a T A 10: 53,908,009 D592V probably damaging Het
Mepe T A 5: 104,337,143 Y50N probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Muc4 T A 16: 32,754,670 S1515T probably benign Het
Nalcn T C 14: 123,291,839 D1408G probably benign Het
Nav1 T C 1: 135,452,853 M1443V unknown Het
Nckap1l A C 15: 103,471,282 N332T possibly damaging Het
Neurl4 T A 11: 69,912,079 L1467Q probably benign Het
Notch2 A G 3: 98,131,402 N1287S probably benign Het
Nr4a3 C T 4: 48,083,203 P579S probably benign Het
Nrxn2 A T 19: 6,517,082 H1329L probably benign Het
Nynrin A T 14: 55,870,400 H988L possibly damaging Het
Olfr1183 A G 2: 88,461,492 T70A probably benign Het
Olfr140 A G 2: 90,051,745 I193T probably benign Het
Olfr394 T A 11: 73,888,001 I124F probably damaging Het
Olfr594 G T 7: 103,220,623 D302Y possibly damaging Het
Olfr855 T A 9: 19,584,560 F8I probably benign Het
Pclo G A 5: 14,793,868 S1534N probably damaging Het
Pign A G 1: 105,585,053 V635A probably benign Het
Pkhd1 T C 1: 20,593,953 T134A probably damaging Het
Plcb4 A T 2: 135,976,148 N790I possibly damaging Het
Plxna2 G T 1: 194,799,779 C1453F probably damaging Het
Plxna4 A G 6: 32,196,122 probably null Het
Pnpla2 A G 7: 141,457,431 I116V possibly damaging Het
Polq A G 16: 37,060,428 T985A probably benign Het
Ppp1r32 T G 19: 10,479,579 D134A probably damaging Het
Pramef6 T C 4: 143,895,886 T300A possibly damaging Het
Prex1 T C 2: 166,713,570 N50S probably benign Het
Ptgfrn G A 3: 101,077,444 A144V probably benign Het
Rad54b G A 4: 11,599,782 G329S probably damaging Het
Rrbp1 A G 2: 143,967,444 L931S probably benign Het
Sipa1l2 A G 8: 125,453,332 S1109P probably damaging Het
Slc26a7 G T 4: 14,546,305 N341K probably damaging Het
Smg1 A C 7: 118,184,977 D958E unknown Het
Smg6 T A 11: 74,930,153 S417T probably benign Het
Srgap3 A G 6: 112,746,921 V550A probably damaging Het
Terb1 T A 8: 104,468,799 D570V probably damaging Het
Tet3 A G 6: 83,368,094 V1787A probably benign Het
Tor1a A T 2: 30,963,741 D192E probably benign Het
Tpr T C 1: 150,447,621 S2379P possibly damaging Het
Trip12 A T 1: 84,750,442 F1138L probably damaging Het
Trpv1 T C 11: 73,260,377 L797P probably damaging Het
Tut1 T C 19: 8,965,334 L595P probably damaging Het
Ubl7 T C 9: 57,914,622 S85P probably damaging Het
Urb1 C A 16: 90,774,768 S1051I probably damaging Het
Usp17le A G 7: 104,768,877 W353R probably damaging Het
Usp44 T C 10: 93,846,468 L260S probably benign Het
Wsb1 T A 11: 79,240,797 probably null Het
Xrcc2 A T 5: 25,692,757 C65S probably damaging Het
Zfp316 T A 5: 143,254,675 M530L probably benign Het
Zfp473 T C 7: 44,733,139 H590R probably damaging Het
Zfp983 T A 17: 21,661,934 H259Q probably damaging Het
Other mutations in Il12rb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Il12rb2 APN 6 67357692 missense probably damaging 0.98
IGL00767:Il12rb2 APN 6 67303562 missense possibly damaging 0.63
IGL00835:Il12rb2 APN 6 67360567 missense probably damaging 0.99
IGL00864:Il12rb2 APN 6 67336754 missense probably benign
IGL00965:Il12rb2 APN 6 67360577 missense probably damaging 0.98
IGL01161:Il12rb2 APN 6 67361865 splice site probably benign
IGL01980:Il12rb2 APN 6 67360535 missense probably benign
IGL02246:Il12rb2 APN 6 67308956 critical splice donor site probably null
IGL02807:Il12rb2 APN 6 67351316 missense probably damaging 1.00
R0003:Il12rb2 UTSW 6 67316286 missense probably damaging 1.00
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0022:Il12rb2 UTSW 6 67298919 missense probably damaging 0.99
R0079:Il12rb2 UTSW 6 67361905 missense probably benign 0.00
R0462:Il12rb2 UTSW 6 67303610 missense possibly damaging 0.95
R0709:Il12rb2 UTSW 6 67298904 splice site probably benign
R0828:Il12rb2 UTSW 6 67356707 missense probably benign
R1051:Il12rb2 UTSW 6 67356735 missense probably benign
R1191:Il12rb2 UTSW 6 67298216 missense possibly damaging 0.90
R1446:Il12rb2 UTSW 6 67309143 missense probably benign
R1559:Il12rb2 UTSW 6 67356592 missense probably benign 0.12
R1677:Il12rb2 UTSW 6 67303501 missense probably damaging 1.00
R1689:Il12rb2 UTSW 6 67336760 missense probably benign 0.01
R1907:Il12rb2 UTSW 6 67295286 nonsense probably null
R1952:Il12rb2 UTSW 6 67292316 missense probably damaging 0.99
R2048:Il12rb2 UTSW 6 67360545 missense probably benign 0.05
R2074:Il12rb2 UTSW 6 67360552 missense probably damaging 1.00
R2351:Il12rb2 UTSW 6 67361944 nonsense probably null
R2358:Il12rb2 UTSW 6 67298195 missense probably damaging 0.96
R2680:Il12rb2 UTSW 6 67354805 missense possibly damaging 0.94
R2920:Il12rb2 UTSW 6 67360568 missense probably damaging 0.96
R3107:Il12rb2 UTSW 6 67360798 missense probably damaging 1.00
R4420:Il12rb2 UTSW 6 67316410 splice site probably null
R4838:Il12rb2 UTSW 6 67309137 missense probably damaging 1.00
R5391:Il12rb2 UTSW 6 67292420 missense probably benign 0.24
R5532:Il12rb2 UTSW 6 67292262 missense probably damaging 1.00
R5696:Il12rb2 UTSW 6 67295278 missense possibly damaging 0.94
R5704:Il12rb2 UTSW 6 67292213 missense possibly damaging 0.53
R5891:Il12rb2 UTSW 6 67360690 missense probably damaging 0.97
R6482:Il12rb2 UTSW 6 67356686 missense probably damaging 1.00
R6749:Il12rb2 UTSW 6 67361966 start gained probably benign
R6813:Il12rb2 UTSW 6 67292374 missense probably damaging 0.98
R6957:Il12rb2 UTSW 6 67292652 missense possibly damaging 0.60
R7312:Il12rb2 UTSW 6 67356633 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- ACCGTTTGCTTAGTACGGAAC -3'
(R):5'- TGGAGGGTGACAGAAACCTC -3'

Sequencing Primer
(F):5'- GGAACGCATACTCAGTAACTTTGC -3'
(R):5'- GGGTGACAGAAACCTCTTGTG -3'
Posted On2019-09-13