Incidental Mutation 'R7362:Bicd1'
ID571413
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene NameBICD cargo adaptor 1
SynonymsB830009D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7362 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location149408886-149563329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 149484093 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 108 (K108T)
Ref Sequence ENSEMBL: ENSMUSP00000084039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000173408]
Predicted Effect probably damaging
Transcript: ENSMUST00000003544
AA Change: K108T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: K108T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086829
AA Change: K108T

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: K108T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111513
AA Change: K108T

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: K108T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173408
AA Change: K108T

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: K108T

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,292,997 Q1393L possibly damaging Het
Adprhl1 C T 8: 13,245,534 R193K probably damaging Het
Aoc1 G T 6: 48,905,411 V74L probably benign Het
Bfsp1 G C 2: 143,826,875 P601A probably benign Het
Btbd18 C T 2: 84,661,543 Q23* probably null Het
Ccser1 A G 6: 61,810,880 I227M unknown Het
Cd151 G A 7: 141,469,589 V70I probably benign Het
Cdh10 A G 15: 18,899,694 T36A probably benign Het
Crb2 A G 2: 37,790,199 T380A probably benign Het
Csmd3 A C 15: 47,755,992 S1829A possibly damaging Het
Dgat2 A T 7: 99,154,636 H359Q probably damaging Het
Dhdds T C 4: 133,971,130 T298A probably benign Het
Egfem1 A G 3: 29,151,920 Q102R probably benign Het
Eps15 T A 4: 109,366,242 probably null Het
Ern1 T A 11: 106,437,123 D61V probably damaging Het
Fcamr G A 1: 130,814,023 R511Q possibly damaging Het
Grhpr T C 4: 44,987,255 V213A probably benign Het
Gsx2 A G 5: 75,076,104 D115G possibly damaging Het
Hoxd3 A G 2: 74,744,219 I70V possibly damaging Het
Inpp5a A G 7: 139,578,380 I408V probably benign Het
Kansl3 A T 1: 36,344,127 D759E possibly damaging Het
Lrrc37a T G 11: 103,457,509 T2787P unknown Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mkln1 T C 6: 31,468,168 I333T probably benign Het
Myt1 T A 2: 181,797,240 V227D probably benign Het
Olfr403 T C 11: 74,195,586 F28L probably benign Het
Olfr593 T A 7: 103,212,654 Y265N probably damaging Het
Olfr863-ps1 C T 9: 19,942,231 D70N probably damaging Het
Pcf11 A G 7: 92,653,245 L1219P possibly damaging Het
Pde6g T C 11: 120,448,124 E80G probably damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp3cb T A 14: 20,523,651 Q304L probably benign Het
Prr19 T C 7: 25,303,918 L319P probably damaging Het
Prss23 C T 7: 89,509,764 A366T probably damaging Het
Rock2 T C 12: 16,958,421 L560P probably damaging Het
Simc1 A T 13: 54,539,704 R95S probably damaging Het
Slc10a6 A T 5: 103,629,126 V36E probably damaging Het
Slco1c1 A T 6: 141,569,463 T695S probably benign Het
Ssh2 T C 11: 77,449,650 F543L probably benign Het
Tecpr2 T A 12: 110,941,476 V999D possibly damaging Het
Tnfsf10 A T 3: 27,335,348 Y186F probably damaging Het
Tnk2 A T 16: 32,675,520 probably null Het
Tram1 T C 1: 13,589,608 M39V probably benign Het
Uck2 C T 1: 167,237,642 V36I possibly damaging Het
Ugcg T A 4: 59,217,109 M211K probably damaging Het
Vash2 A T 1: 190,960,299 S226R probably damaging Het
Vmn1r172 T A 7: 23,660,416 M242K probably damaging Het
Vmn2r82 A T 10: 79,396,617 M817L probably benign Het
Vwa5b1 T C 4: 138,594,312 N390S probably damaging Het
Wdr73 T A 7: 80,900,703 D17V probably damaging Het
Wdr91 A T 6: 34,889,115 S501T possibly damaging Het
Zfp454 A G 11: 50,886,367 probably null Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0131:Bicd1 UTSW 6 149512947 missense probably damaging 0.99
R0134:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0225:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149511962 missense probably benign 0.34
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5527:Bicd1 UTSW 6 149494636 missense probably damaging 1.00
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
R7526:Bicd1 UTSW 6 149513726 missense possibly damaging 0.46
R7545:Bicd1 UTSW 6 149513492 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTTTCAATCCTCCCAGACTG -3'
(R):5'- AAGAGTTGGTCTATAGTTTGGCAC -3'

Sequencing Primer
(F):5'- CCAGACTGGGTATGAGTTATTACAC -3'
(R):5'- ACACATGTCTCTGTAAGGGGATTTC -3'
Posted On2019-09-13