Incidental Mutation 'R7363:Nckap1'
ID571453
Institutional Source Beutler Lab
Gene Symbol Nckap1
Ensembl Gene ENSMUSG00000027002
Gene NameNCK-associated protein 1
Synonymsmh19, Hem-2, Nap1, Hem2, H19
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7363 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location80500512-80581380 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 80540168 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 393 (R393C)
Ref Sequence ENSEMBL: ENSMUSP00000107390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028386] [ENSMUST00000111760]
Predicted Effect probably damaging
Transcript: ENSMUST00000028386
AA Change: R387C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028386
Gene: ENSMUSG00000027002
AA Change: R387C

DomainStartEndE-ValueType
Pfam:Nckap1 8 1124 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111760
AA Change: R393C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107390
Gene: ENSMUSG00000027002
AA Change: R393C

DomainStartEndE-ValueType
Pfam:Nckap1 9 1128 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene exhibit growth arrest at midgestation, an open neural tube, cardia bifida, defective foregut development, defects in endoderm and mesoderm migration and sometimes duplication of the anteroposterior body axis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,770 N190I probably damaging Het
Ablim1 G T 19: 57,215,741 L73I probably benign Het
Adamts4 A T 1: 171,259,039 Q800L probably benign Het
Atm A T 9: 53,465,298 I2014N probably damaging Het
Atp2a1 A G 7: 126,462,889 C12R possibly damaging Het
B3galnt1 A T 3: 69,575,824 Y35N probably damaging Het
Bnc2 A T 4: 84,292,071 M687K probably benign Het
Cacna2d4 A G 6: 119,343,978 Y917C probably damaging Het
Cldn23 A G 8: 35,825,505 probably null Het
Cntn5 G T 9: 10,172,016 S54R probably benign Het
Dido1 G T 2: 180,662,517 S1198* probably null Het
Dnah12 A G 14: 26,724,611 M776V probably benign Het
Dnttip1 GGGCCGGC GGGC 2: 164,757,685 probably null Het
Dusp28 A T 1: 92,907,139 T29S probably benign Het
Erich1 A T 8: 14,033,688 S127R probably benign Het
Fam151a T A 4: 106,745,484 L200H probably damaging Het
Fam71a A T 1: 191,163,713 S244R probably damaging Het
Fbxw8 A T 5: 118,124,992 H207Q probably damaging Het
Fgf22 A G 10: 79,756,842 E116G probably benign Het
Gapvd1 C A 2: 34,712,195 V647F probably benign Het
Gja4 T A 4: 127,312,694 Y92F probably damaging Het
Gtf3c2 G A 5: 31,170,256 R288W probably damaging Het
Hira G T 16: 18,897,782 R99L possibly damaging Het
Ighv16-1 C T 12: 114,069,101 G27D probably damaging Het
Igkv1-133 C T 6: 67,725,411 P38S probably benign Het
Igkv4-59 T C 6: 69,438,412 Y53C probably damaging Het
Il23a T C 10: 128,297,151 E113G probably damaging Het
Kcnip1 A G 11: 33,634,589 V188A probably benign Het
L3mbtl3 T C 10: 26,340,952 K155E unknown Het
Lancl2 T G 6: 57,722,679 C169G probably benign Het
Lrrc26 A G 2: 25,290,569 D194G probably benign Het
Lrrfip1 C T 1: 91,123,120 A545V probably benign Het
Lrtm1 T C 14: 29,021,893 F106S probably damaging Het
Lypd2 A T 15: 74,732,999 M49K probably damaging Het
Mbd1 A C 18: 74,273,286 D63A probably damaging Het
Mdn1 T C 4: 32,691,729 F990L probably damaging Het
Mtfr1l T C 4: 134,529,266 E196G probably benign Het
Myh10 A G 11: 68,815,048 T2007A probably benign Het
Nup205 C T 6: 35,232,573 T1605M probably benign Het
Olfr1052 GTACTTTTT GT 2: 86,297,994 probably null Het
Olfr393 T C 11: 73,847,915 D70G probably damaging Het
Pitrm1 A G 13: 6,569,351 S741G probably benign Het
Plcd4 A T 1: 74,551,072 S155C probably null Het
Poc5 A T 13: 96,404,417 T365S possibly damaging Het
Ppp2r5c G A 12: 110,522,607 A71T probably benign Het
Prdm6 T A 18: 53,465,127 I187N possibly damaging Het
Pxk A G 14: 8,152,118 Q478R probably benign Het
Rgl1 T C 1: 152,519,163 Y718C probably damaging Het
Ring1 G T 17: 34,024,362 T2K possibly damaging Het
Sdk1 A G 5: 142,188,142 S2022G probably benign Het
Sec61a1 C A 6: 88,515,551 V32F probably benign Het
Sv2b G A 7: 75,147,654 P331S probably damaging Het
Syne1 T C 10: 5,140,970 S795G possibly damaging Het
Tmem2 T C 19: 21,856,211 F1338L probably benign Het
Tmod2 T C 9: 75,576,741 E309G probably damaging Het
Tpp2 T G 1: 43,985,422 S987A probably benign Het
Trim75 G C 8: 64,982,887 H304D probably damaging Het
Trp53bp2 G T 1: 182,444,666 D447Y probably damaging Het
Ube3a A G 7: 59,287,003 K697E probably benign Het
Vmn2r13 T A 5: 109,192,043 H22L probably benign Het
Vmn2r4 G A 3: 64,407,011 S183F probably damaging Het
Vwa8 T C 14: 79,018,707 Y721H probably benign Het
Wbp1l C T 19: 46,654,130 P190L possibly damaging Het
Zcchc4 A T 5: 52,785,168 Q105L possibly damaging Het
Zfp236 T C 18: 82,621,331 R1264G probably damaging Het
Zfpm2 T A 15: 40,753,017 N54K probably damaging Het
Zkscan3 C T 13: 21,387,822 G547S probably damaging Het
Other mutations in Nckap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Nckap1 APN 2 80506202 missense possibly damaging 0.87
IGL00896:Nckap1 APN 2 80580953 missense possibly damaging 0.59
IGL01343:Nckap1 APN 2 80519842 missense possibly damaging 0.81
IGL01593:Nckap1 APN 2 80520570 missense probably benign 0.06
IGL01677:Nckap1 APN 2 80530297 missense probably benign 0.04
IGL01873:Nckap1 APN 2 80553385 missense possibly damaging 0.95
IGL01874:Nckap1 APN 2 80525636 missense probably damaging 1.00
IGL01947:Nckap1 APN 2 80508753 missense probably damaging 1.00
IGL02268:Nckap1 APN 2 80528618 missense probably benign 0.16
IGL02348:Nckap1 APN 2 80517982 missense probably damaging 1.00
IGL03349:Nckap1 APN 2 80525560 missense probably benign 0.07
PIT4151001:Nckap1 UTSW 2 80520370 critical splice donor site probably null
R0326:Nckap1 UTSW 2 80553370 missense probably benign 0.41
R0345:Nckap1 UTSW 2 80544977 splice site probably benign
R0520:Nckap1 UTSW 2 80541530 splice site probably benign
R0603:Nckap1 UTSW 2 80512729 missense probably benign 0.19
R0924:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0930:Nckap1 UTSW 2 80554249 missense probably benign 0.34
R0964:Nckap1 UTSW 2 80547899 critical splice donor site probably null
R1122:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1123:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1124:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1125:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1127:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1182:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1234:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1236:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1384:Nckap1 UTSW 2 80533670 missense possibly damaging 0.90
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1402:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1511:Nckap1 UTSW 2 80553415 missense probably damaging 0.99
R1677:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1686:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1687:Nckap1 UTSW 2 80520585 missense probably damaging 0.96
R1717:Nckap1 UTSW 2 80512670 splice site probably benign
R1789:Nckap1 UTSW 2 80520556 missense probably benign 0.44
R1822:Nckap1 UTSW 2 80517898 missense possibly damaging 0.58
R1840:Nckap1 UTSW 2 80502250 missense possibly damaging 0.88
R1926:Nckap1 UTSW 2 80506838 missense probably damaging 1.00
R1968:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R1970:Nckap1 UTSW 2 80517942 missense probably benign 0.12
R2027:Nckap1 UTSW 2 80535518 missense probably damaging 1.00
R2063:Nckap1 UTSW 2 80570150 missense probably damaging 1.00
R2504:Nckap1 UTSW 2 80530218 missense probably benign 0.40
R3824:Nckap1 UTSW 2 80540560 missense possibly damaging 0.72
R4784:Nckap1 UTSW 2 80506934 missense probably benign 0.15
R4908:Nckap1 UTSW 2 80523374 critical splice donor site probably null
R5077:Nckap1 UTSW 2 80548933 missense probably damaging 0.99
R5311:Nckap1 UTSW 2 80540122 missense probably damaging 1.00
R5439:Nckap1 UTSW 2 80512690 missense possibly damaging 0.81
R6141:Nckap1 UTSW 2 80530207 missense probably damaging 1.00
R6209:Nckap1 UTSW 2 80525602 missense probably damaging 1.00
R6226:Nckap1 UTSW 2 80508781 missense possibly damaging 0.96
R6294:Nckap1 UTSW 2 80541514 missense probably benign 0.03
R6458:Nckap1 UTSW 2 80512549 intron probably null
R6937:Nckap1 UTSW 2 80508716 missense probably damaging 1.00
R6986:Nckap1 UTSW 2 80520567 missense probably benign 0.03
R7180:Nckap1 UTSW 2 80506892 missense probably benign 0.01
R7208:Nckap1 UTSW 2 80540198 missense probably benign 0.24
R7448:Nckap1 UTSW 2 80524541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTATATTGCCCAGATGTATTCC -3'
(R):5'- AGAATGCATTTGCTGGCTTGAG -3'

Sequencing Primer
(F):5'- TTCTCAGACTCATGACCC -3'
(R):5'- TTGAGGCTCGCATCACAC -3'
Posted On2019-09-13