Incidental Mutation 'R7296:Vmn2r60'
ID571622
Institutional Source Beutler Lab
Gene Symbol Vmn2r60
Ensembl Gene ENSMUSG00000090619
Gene Namevomeronasal 2, receptor 60
SynonymsGprc2a-rs3, Casr-rs3, EG637898
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7296 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location42116471-42195776 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42136402 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 210 (S210T)
Ref Sequence ENSEMBL: ENSMUSP00000128493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166447]
Predicted Effect probably benign
Transcript: ENSMUST00000166447
AA Change: S210T

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000128493
Gene: ENSMUSG00000090619
AA Change: S210T

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 78 471 1.2e-44 PFAM
Pfam:NCD3G 514 567 5.1e-23 PFAM
Pfam:7tm_3 600 835 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,143 M226K probably benign Het
2010300C02Rik T C 1: 37,614,618 T1036A possibly damaging Het
4921524L21Rik T G 18: 6,626,385 S132R probably damaging Het
A4gnt T G 9: 99,620,282 I165S probably damaging Het
Abca14 G A 7: 120,278,311 D1061N probably benign Het
Abcc9 G A 6: 142,671,593 P582S probably damaging Het
Abhd5 G A 9: 122,379,573 V343I probably benign Het
Adam6a C T 12: 113,545,572 R522C probably damaging Het
Ankle2 G A 5: 110,237,724 R313H probably damaging Het
Aplf G A 6: 87,646,215 T315I probably damaging Het
Arntl2 G A 6: 146,822,134 V321I not run Het
Asic5 C T 3: 82,021,076 P491S probably benign Het
Atp5b T C 10: 128,085,522 Y230H probably benign Het
B4galt6 A T 18: 20,728,042 I51N probably damaging Het
C4b A G 17: 34,743,659 L23S probably damaging Het
C77080 A G 4: 129,225,418 Y170H probably damaging Het
Cables2 A G 2: 180,260,336 V410A Het
Cdyl A G 13: 35,863,395 M489V probably damaging Het
Clip4 T C 17: 71,790,001 M40T probably damaging Het
Col12a1 T C 9: 79,682,066 Y1069C probably damaging Het
Col6a3 T C 1: 90,827,986 M194V probably benign Het
Colec11 T A 12: 28,594,715 D260V probably damaging Het
Cux2 T C 5: 121,861,256 D1207G probably benign Het
Cyp2d34 G T 15: 82,617,235 N297K possibly damaging Het
Dmbt1 A G 7: 131,112,132 Y1643C unknown Het
Dnmt3c A G 2: 153,715,026 T288A probably benign Het
Dock8 T A 19: 25,184,881 F1842I probably benign Het
Dysf A G 6: 84,106,898 I740V probably benign Het
Epha6 T A 16: 59,915,838 M778L probably benign Het
Eri2 A T 7: 119,786,516 L254* probably null Het
Fam129b T C 2: 32,922,642 S468P possibly damaging Het
Fam43b A G 4: 138,395,841 F56S probably damaging Het
Fat4 C A 3: 38,889,145 S729* probably null Het
Fbxw22 C A 9: 109,382,075 W386L probably benign Het
Fgd6 T A 10: 94,044,047 C254* probably null Het
Fgd6 C A 10: 94,139,881 T1386K probably benign Het
Fkbp7 G T 2: 76,671,764 D98E possibly damaging Het
Gm8251 T A 1: 44,060,916 K341* probably null Het
Hectd1 C T 12: 51,785,852 C913Y possibly damaging Het
Hgf T A 5: 16,564,843 M105K probably benign Het
Icam1 A C 9: 21,019,015 D55A probably benign Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Klra17 T A 6: 129,831,592 N226I possibly damaging Het
Krt1 T A 15: 101,850,629 R33S unknown Het
L3mbtl3 T A 10: 26,282,830 D615V unknown Het
Lrp2 T A 2: 69,482,381 Y2521F probably benign Het
Megf10 A T 18: 57,275,753 N589I probably damaging Het
Metap1d G C 2: 71,506,785 G14A probably benign Het
Mfap5 T A 6: 122,528,422 D162E probably benign Het
Mixl1 T C 1: 180,696,958 I19V probably benign Het
Mtrr G T 13: 68,568,860 Y411* probably null Het
Myh7 T C 14: 54,990,025 T318A probably benign Het
Nbeal1 T A 1: 60,310,224 Y2348* probably null Het
Nlrc3 T C 16: 3,963,590 S668G probably damaging Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1129 T A 2: 87,575,708 V208E probably damaging Het
Olfr1222 C A 2: 89,124,836 R298S probably benign Het
Olfr527 A T 7: 140,336,741 D293V possibly damaging Het
Pcna A G 2: 132,252,877 S54P probably benign Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Phf21b A T 15: 84,855,717 M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prob1 A G 18: 35,653,299 F634S possibly damaging Het
Prss50 A G 9: 110,861,289 T167A probably damaging Het
Ptpn1 T C 2: 167,974,772 V249A probably damaging Het
Rai1 G A 11: 60,188,673 V1188I probably benign Het
Ric1 G A 19: 29,584,578 probably null Het
Robo1 C T 16: 72,989,631 Q844* probably null Het
Rpn1 A G 6: 88,084,637 D36G possibly damaging Het
Serpinb1b A T 13: 33,093,827 M348L probably benign Het
Setd5 T G 6: 113,147,557 S1124A probably benign Het
Slc35c1 C A 2: 92,458,739 V154F probably damaging Het
Slc7a6os G T 8: 106,210,489 S113* probably null Het
Syne2 T A 12: 76,103,036 D1787E probably benign Het
Tas2r144 A C 6: 42,215,439 I38L probably damaging Het
Tepsin G T 11: 120,091,708 T512K possibly damaging Het
Utp20 A G 10: 88,770,724 V1662A probably benign Het
Vmn1r201 C T 13: 22,475,339 A241V possibly damaging Het
Wdr6 G T 9: 108,574,585 H700N probably damaging Het
Zdhhc8 T C 16: 18,234,926 T29A probably benign Het
Zfp335 A G 2: 164,900,132 I614T probably damaging Het
Zfp54 T A 17: 21,433,582 S113T probably benign Het
Zfp873 T A 10: 82,061,237 C601S probably damaging Het
Zmynd8 T C 2: 165,840,009 T201A probably damaging Het
Other mutations in Vmn2r60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL01623:Vmn2r60 APN 7 42136486 missense probably benign 0.09
IGL02363:Vmn2r60 APN 7 42195154 missense probably benign 0.02
IGL02485:Vmn2r60 APN 7 42195466 missense possibly damaging 0.54
IGL02651:Vmn2r60 APN 7 42195586 missense probably damaging 0.99
IGL02660:Vmn2r60 APN 7 42142296 nonsense probably null
IGL03135:Vmn2r60 APN 7 42136594 missense probably benign 0.13
IGL03307:Vmn2r60 APN 7 42116547 missense probably benign 0.14
R0310:Vmn2r60 UTSW 7 42195140 missense possibly damaging 0.54
R0314:Vmn2r60 UTSW 7 42135561 splice site probably benign
R0328:Vmn2r60 UTSW 7 42142320 splice site probably benign
R0464:Vmn2r60 UTSW 7 42135831 missense probably damaging 0.99
R0755:Vmn2r60 UTSW 7 42195445 missense probably damaging 1.00
R1119:Vmn2r60 UTSW 7 42194941 missense possibly damaging 0.68
R1162:Vmn2r60 UTSW 7 42195771 missense probably benign 0.29
R1241:Vmn2r60 UTSW 7 42137052 missense probably benign 0.01
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1404:Vmn2r60 UTSW 7 42136787 missense probably damaging 0.99
R1488:Vmn2r60 UTSW 7 42136713 missense probably benign 0.17
R1623:Vmn2r60 UTSW 7 42135855 nonsense probably null
R1628:Vmn2r60 UTSW 7 42136406 nonsense probably null
R1883:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R1884:Vmn2r60 UTSW 7 42136670 missense probably damaging 0.99
R2182:Vmn2r60 UTSW 7 42195507 missense probably benign 0.06
R2275:Vmn2r60 UTSW 7 42136827 nonsense probably null
R2847:Vmn2r60 UTSW 7 42136433 missense probably benign 0.07
R2885:Vmn2r60 UTSW 7 42140979 missense possibly damaging 0.91
R2894:Vmn2r60 UTSW 7 42135796 missense probably benign
R2921:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R2922:Vmn2r60 UTSW 7 42141035 missense probably damaging 0.98
R3772:Vmn2r60 UTSW 7 42116556 missense probably benign 0.35
R3820:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3822:Vmn2r60 UTSW 7 42135701 missense probably damaging 0.98
R3872:Vmn2r60 UTSW 7 42136454 missense probably benign 0.19
R4222:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4223:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4224:Vmn2r60 UTSW 7 42116528 missense probably benign 0.08
R4526:Vmn2r60 UTSW 7 42195243 missense probably damaging 0.96
R4547:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R4840:Vmn2r60 UTSW 7 42135861 missense probably damaging 1.00
R5173:Vmn2r60 UTSW 7 42195511 missense probably damaging 0.97
R5231:Vmn2r60 UTSW 7 42137024 missense possibly damaging 0.93
R5480:Vmn2r60 UTSW 7 42135730 missense probably damaging 0.98
R5521:Vmn2r60 UTSW 7 42195625 missense probably damaging 0.99
R5834:Vmn2r60 UTSW 7 42116508 missense probably benign 0.17
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6038:Vmn2r60 UTSW 7 42194962 missense probably benign 0.04
R6112:Vmn2r60 UTSW 7 42195423 missense probably damaging 1.00
R6149:Vmn2r60 UTSW 7 42136976 missense probably damaging 1.00
R6170:Vmn2r60 UTSW 7 42135621 missense possibly damaging 0.94
R6383:Vmn2r60 UTSW 7 42116471 start codon destroyed probably null 0.04
R6811:Vmn2r60 UTSW 7 42194886 missense probably damaging 1.00
R6876:Vmn2r60 UTSW 7 42135663 missense probably null 0.54
R6997:Vmn2r60 UTSW 7 42142292 missense probably benign 0.00
R7040:Vmn2r60 UTSW 7 42142242 missense probably benign 0.00
R7116:Vmn2r60 UTSW 7 42137063 missense probably benign 0.00
R7128:Vmn2r60 UTSW 7 42195112 missense probably damaging 0.96
R7232:Vmn2r60 UTSW 7 42136742 missense possibly damaging 0.83
R7376:Vmn2r60 UTSW 7 42195207 missense probably damaging 1.00
R7526:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7527:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7528:Vmn2r60 UTSW 7 42195734 frame shift probably null
R7529:Vmn2r60 UTSW 7 42195734 frame shift probably null
X0023:Vmn2r60 UTSW 7 42141114 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTTACAGGGCAAGTCCATTTTC -3'
(R):5'- GACATTTGCTGATGATTCCTCAATC -3'

Sequencing Primer
(F):5'- AGGGCAAGTCCATTTTCATCTTGAC -3'
(R):5'- GATGATTCCTCAATCTTCTCCATAC -3'
Posted On2019-09-13