Incidental Mutation 'R7296:Ric1'
ID571670
Institutional Source Beutler Lab
Gene Symbol Ric1
Ensembl Gene ENSMUSG00000038658
Gene NameRAB6A GEF complex partner 1
SynonymsC030046E11Rik, C130057E09Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.537) question?
Stock #R7296 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location29522282-29606829 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 29584578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000043437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043610]
Predicted Effect probably null
Transcript: ENSMUST00000043610
SMART Domains Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658

DomainStartEndE-ValueType
Blast:WD40 242 278 5e-7 BLAST
SCOP:d1gxra_ 254 379 2e-4 SMART
Blast:WD40 285 334 3e-6 BLAST
Blast:WD40 482 520 5e-6 BLAST
low complexity region 642 653 N/A INTRINSIC
Pfam:RIC1 732 991 1.9e-86 PFAM
low complexity region 1120 1132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162492
SMART Domains Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658

DomainStartEndE-ValueType
Blast:WD40 171 207 4e-7 BLAST
SCOP:d1gxra_ 183 308 2e-4 SMART
Blast:WD40 214 263 2e-6 BLAST
low complexity region 534 545 N/A INTRINSIC
Pfam:RIC1 624 883 1.6e-86 PFAM
low complexity region 1012 1024 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,143 M226K probably benign Het
2010300C02Rik T C 1: 37,614,618 T1036A possibly damaging Het
4921524L21Rik T G 18: 6,626,385 S132R probably damaging Het
A4gnt T G 9: 99,620,282 I165S probably damaging Het
Abca14 G A 7: 120,278,311 D1061N probably benign Het
Abcc9 G A 6: 142,671,593 P582S probably damaging Het
Abhd5 G A 9: 122,379,573 V343I probably benign Het
Adam6a C T 12: 113,545,572 R522C probably damaging Het
Ankle2 G A 5: 110,237,724 R313H probably damaging Het
Aplf G A 6: 87,646,215 T315I probably damaging Het
Arntl2 G A 6: 146,822,134 V321I not run Het
Asic5 C T 3: 82,021,076 P491S probably benign Het
Atp5b T C 10: 128,085,522 Y230H probably benign Het
B4galt6 A T 18: 20,728,042 I51N probably damaging Het
C4b A G 17: 34,743,659 L23S probably damaging Het
C77080 A G 4: 129,225,418 Y170H probably damaging Het
Cables2 A G 2: 180,260,336 V410A Het
Cdyl A G 13: 35,863,395 M489V probably damaging Het
Clip4 T C 17: 71,790,001 M40T probably damaging Het
Col12a1 T C 9: 79,682,066 Y1069C probably damaging Het
Col6a3 T C 1: 90,827,986 M194V probably benign Het
Colec11 T A 12: 28,594,715 D260V probably damaging Het
Cux2 T C 5: 121,861,256 D1207G probably benign Het
Cyp2d34 G T 15: 82,617,235 N297K possibly damaging Het
Dmbt1 A G 7: 131,112,132 Y1643C unknown Het
Dnmt3c A G 2: 153,715,026 T288A probably benign Het
Dock8 T A 19: 25,184,881 F1842I probably benign Het
Dysf A G 6: 84,106,898 I740V probably benign Het
Epha6 T A 16: 59,915,838 M778L probably benign Het
Eri2 A T 7: 119,786,516 L254* probably null Het
Fam129b T C 2: 32,922,642 S468P possibly damaging Het
Fam43b A G 4: 138,395,841 F56S probably damaging Het
Fat4 C A 3: 38,889,145 S729* probably null Het
Fbxw22 C A 9: 109,382,075 W386L probably benign Het
Fgd6 T A 10: 94,044,047 C254* probably null Het
Fgd6 C A 10: 94,139,881 T1386K probably benign Het
Fkbp7 G T 2: 76,671,764 D98E possibly damaging Het
Gm8251 T A 1: 44,060,916 K341* probably null Het
Hectd1 C T 12: 51,785,852 C913Y possibly damaging Het
Hgf T A 5: 16,564,843 M105K probably benign Het
Icam1 A C 9: 21,019,015 D55A probably benign Het
Kcnj5 A C 9: 32,322,749 L90R probably damaging Het
Klra17 T A 6: 129,831,592 N226I possibly damaging Het
Krt1 T A 15: 101,850,629 R33S unknown Het
L3mbtl3 T A 10: 26,282,830 D615V unknown Het
Lrp2 T A 2: 69,482,381 Y2521F probably benign Het
Megf10 A T 18: 57,275,753 N589I probably damaging Het
Metap1d G C 2: 71,506,785 G14A probably benign Het
Mfap5 T A 6: 122,528,422 D162E probably benign Het
Mixl1 T C 1: 180,696,958 I19V probably benign Het
Mtrr G T 13: 68,568,860 Y411* probably null Het
Myh7 T C 14: 54,990,025 T318A probably benign Het
Nbeal1 T A 1: 60,310,224 Y2348* probably null Het
Nlrc3 T C 16: 3,963,590 S668G probably damaging Het
Nutm1 G A 2: 112,250,056 R505C probably damaging Het
Olfr1129 T A 2: 87,575,708 V208E probably damaging Het
Olfr1222 C A 2: 89,124,836 R298S probably benign Het
Olfr527 A T 7: 140,336,741 D293V possibly damaging Het
Pcna A G 2: 132,252,877 S54P probably benign Het
Pde6a A G 18: 61,258,293 T570A probably damaging Het
Phf21b A T 15: 84,855,717 M1K probably null Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Prob1 A G 18: 35,653,299 F634S possibly damaging Het
Prss50 A G 9: 110,861,289 T167A probably damaging Het
Ptpn1 T C 2: 167,974,772 V249A probably damaging Het
Rai1 G A 11: 60,188,673 V1188I probably benign Het
Robo1 C T 16: 72,989,631 Q844* probably null Het
Rpn1 A G 6: 88,084,637 D36G possibly damaging Het
Serpinb1b A T 13: 33,093,827 M348L probably benign Het
Setd5 T G 6: 113,147,557 S1124A probably benign Het
Slc35c1 C A 2: 92,458,739 V154F probably damaging Het
Slc7a6os G T 8: 106,210,489 S113* probably null Het
Syne2 T A 12: 76,103,036 D1787E probably benign Het
Tas2r144 A C 6: 42,215,439 I38L probably damaging Het
Tepsin G T 11: 120,091,708 T512K possibly damaging Het
Utp20 A G 10: 88,770,724 V1662A probably benign Het
Vmn1r201 C T 13: 22,475,339 A241V possibly damaging Het
Vmn2r60 T A 7: 42,136,402 S210T probably benign Het
Wdr6 G T 9: 108,574,585 H700N probably damaging Het
Zdhhc8 T C 16: 18,234,926 T29A probably benign Het
Zfp335 A G 2: 164,900,132 I614T probably damaging Het
Zfp54 T A 17: 21,433,582 S113T probably benign Het
Zfp873 T A 10: 82,061,237 C601S probably damaging Het
Zmynd8 T C 2: 165,840,009 T201A probably damaging Het
Other mutations in Ric1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Ric1 APN 19 29595362 missense probably damaging 1.00
IGL00902:Ric1 APN 19 29567231 missense probably benign 0.05
IGL01405:Ric1 APN 19 29567370 splice site probably benign
IGL01629:Ric1 APN 19 29603981 missense probably benign 0.02
IGL01688:Ric1 APN 19 29577614 missense probably benign 0.00
IGL01966:Ric1 APN 19 29595563 missense probably benign 0.33
IGL02123:Ric1 APN 19 29594800 missense probably benign
IGL02590:Ric1 APN 19 29567481 splice site probably benign
IGL02655:Ric1 APN 19 29595451 missense probably damaging 1.00
IGL02699:Ric1 APN 19 29522557 missense possibly damaging 0.51
IGL02718:Ric1 APN 19 29533240 missense probably damaging 1.00
IGL03026:Ric1 APN 19 29599833 missense probably benign 0.02
IGL03142:Ric1 APN 19 29600980 missense possibly damaging 0.89
R0109:Ric1 UTSW 19 29586677 synonymous silent
R0336:Ric1 UTSW 19 29587793 missense probably damaging 0.96
R0362:Ric1 UTSW 19 29601011 critical splice donor site probably null
R0676:Ric1 UTSW 19 29577647 missense probably benign
R0734:Ric1 UTSW 19 29594818 missense possibly damaging 0.66
R1004:Ric1 UTSW 19 29602357 missense probably benign 0.00
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1148:Ric1 UTSW 19 29579849 missense probably benign
R1216:Ric1 UTSW 19 29577735 missense probably benign 0.00
R1493:Ric1 UTSW 19 29579849 missense probably benign
R1848:Ric1 UTSW 19 29600813 splice site probably null
R1872:Ric1 UTSW 19 29602668 missense probably benign 0.32
R1942:Ric1 UTSW 19 29601016 splice site probably benign
R2143:Ric1 UTSW 19 29533252 missense probably damaging 1.00
R2143:Ric1 UTSW 19 29533253 missense probably damaging 0.96
R2679:Ric1 UTSW 19 29604030 missense probably benign
R2878:Ric1 UTSW 19 29602330 missense possibly damaging 0.77
R2970:Ric1 UTSW 19 29577718 missense probably benign 0.15
R3420:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3421:Ric1 UTSW 19 29567590 missense probably damaging 0.96
R3940:Ric1 UTSW 19 29570762 missense probably damaging 1.00
R4004:Ric1 UTSW 19 29579801 missense probably benign 0.44
R4225:Ric1 UTSW 19 29602731 missense possibly damaging 0.89
R4280:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4283:Ric1 UTSW 19 29586550 missense probably damaging 1.00
R4516:Ric1 UTSW 19 29570765 missense probably benign 0.17
R4702:Ric1 UTSW 19 29598017 missense possibly damaging 0.85
R4824:Ric1 UTSW 19 29585842 missense probably damaging 1.00
R4835:Ric1 UTSW 19 29595536 missense possibly damaging 0.80
R5860:Ric1 UTSW 19 29599845 missense possibly damaging 0.91
R5883:Ric1 UTSW 19 29595989 missense probably damaging 1.00
R5965:Ric1 UTSW 19 29570771 missense probably damaging 0.99
R6141:Ric1 UTSW 19 29595442 missense probably damaging 1.00
R6236:Ric1 UTSW 19 29595426 missense possibly damaging 0.91
R6271:Ric1 UTSW 19 29567365 splice site probably null
R6345:Ric1 UTSW 19 29604085 missense probably benign 0.09
R6371:Ric1 UTSW 19 29562026 missense probably benign 0.35
R6547:Ric1 UTSW 19 29594826 missense probably damaging 1.00
R6924:Ric1 UTSW 19 29569388 missense probably damaging 0.98
R6969:Ric1 UTSW 19 29585782 missense probably damaging 1.00
R6970:Ric1 UTSW 19 29587772 missense probably damaging 1.00
R6993:Ric1 UTSW 19 29586613 missense probably damaging 1.00
R7434:Ric1 UTSW 19 29574780 missense probably damaging 1.00
X0064:Ric1 UTSW 19 29587802 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTAGTGGGTCTCCGCCAC -3'
(R):5'- TGGTCTTAACAAGAATGAAAAGCC -3'

Sequencing Primer
(F):5'- GCCACACTTTGTCAATATTTAGGC -3'
(R):5'- AGCCAATTAACTCAATGAAAGAGC -3'
Posted On2019-09-13