Incidental Mutation 'R7366:Cc2d2a'
ID571788
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R7366 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43729990 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 1315 (R1315L)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect probably damaging
Transcript: ENSMUST00000048150
AA Change: R1315L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: R1315L

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000125866
AA Change: R1254L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: R1254L

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik C T 8: 72,449,459 P244S possibly damaging Het
4930404N11Rik T C 10: 81,364,191 D165G possibly damaging Het
4930562C15Rik A G 16: 4,835,769 I61V unknown Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Acbd3 A G 1: 180,734,499 E181G probably benign Het
Ano3 T C 2: 110,757,067 Y43C probably damaging Het
Aspa T A 11: 73,319,890 probably null Het
AU018091 A T 7: 3,156,330 N620K probably damaging Het
Bicc1 G T 10: 70,943,386 T724K probably benign Het
Bmper T C 9: 23,484,004 I677T probably damaging Het
C3 T A 17: 57,221,162 T686S probably benign Het
Ccdc150 G T 1: 54,300,382 E462* probably null Het
Ccdc88c C A 12: 100,944,950 R875L possibly damaging Het
Cd177 C T 7: 24,756,722 G207D probably damaging Het
Cdh23 A T 10: 60,315,692 Y2471* probably null Het
Cmbl A T 15: 31,589,856 Y244F probably benign Het
Dcaf10 T C 4: 45,373,919 V448A probably damaging Het
Ddr2 A G 1: 169,997,964 W356R probably damaging Het
Depdc1a A G 3: 159,523,212 I534V probably benign Het
Dhtkd1 T A 2: 5,917,906 I481L probably benign Het
Dlst A T 12: 85,128,315 I260L probably benign Het
Dnajc13 T G 9: 104,184,706 K1350Q probably benign Het
Dpp4 T C 2: 62,354,599 Y520C probably damaging Het
Dr1 C A 5: 108,275,728 A127E unknown Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
E130308A19Rik T C 4: 59,752,770 C628R probably damaging Het
Fam20a T A 11: 109,673,342 Q528H possibly damaging Het
Fanca T C 8: 123,281,213 E981G probably benign Het
Fbp2 A G 13: 62,837,198 V303A possibly damaging Het
Flii C T 11: 60,721,119 V353M possibly damaging Het
Gm10277 T A 11: 77,785,758 Y129F unknown Het
Gm3159 A T 14: 4,398,525 H72L probably benign Het
Gm5114 T G 7: 39,409,344 T284P possibly damaging Het
Gm7168 T C 17: 13,949,885 S505P probably damaging Het
Gnal T C 18: 67,211,071 V239A possibly damaging Het
Gtf2i C T 5: 134,265,749 E370K probably damaging Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Il3 T A 11: 54,265,883 R93S probably benign Het
Itsn1 A G 16: 91,908,450 E1573G unknown Het
Kif26a G A 12: 112,163,542 probably null Het
Klb T C 5: 65,372,431 M434T probably damaging Het
Lrp2 T A 2: 69,483,806 R2194W probably damaging Het
Mak16 A G 8: 31,166,099 Y119H possibly damaging Het
Map3k19 T A 1: 127,817,455 M1421L probably damaging Het
Mbd5 A G 2: 49,274,568 I1186V probably benign Het
Mboat1 T A 13: 30,202,362 C120S possibly damaging Het
Mctp2 T A 7: 72,259,214 D117V probably benign Het
Mocos C A 18: 24,676,616 N425K probably damaging Het
Ngfr A T 11: 95,574,429 W198R possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Obsl1 T C 1: 75,502,964 S596G probably damaging Het
Olfr111 T A 17: 37,530,817 V280D probably damaging Het
Olfr1414 A G 1: 92,511,678 S117P possibly damaging Het
Olfr578 A T 7: 102,984,516 I216K probably damaging Het
Olfr594 T G 7: 103,220,533 Y272D probably benign Het
Olfr705 G T 7: 106,873,396 P283Q probably damaging Het
Plcb3 T C 19: 6,962,021 T530A probably benign Het
Prss40 A T 1: 34,559,871 Y70* probably null Het
Ralgps1 T C 2: 33,324,688 M61V possibly damaging Het
Rbp4 C T 19: 38,124,962 R36H possibly damaging Het
Rnf125 A G 18: 20,974,433 N7S not run Het
Rpe65 G A 3: 159,624,729 S511N probably benign Het
Rspo4 A T 2: 151,867,873 Y66F probably damaging Het
Ruvbl2 A G 7: 45,422,149 S437P probably benign Het
Sele C A 1: 164,048,719 R12S probably benign Het
Sgo2b T A 8: 63,938,417 K139* probably null Het
Shroom3 C A 5: 92,964,606 S1942* probably null Het
Slc12a9 G A 5: 137,328,623 R191* probably null Het
Spag9 G T 11: 94,108,521 V1088L possibly damaging Het
Sptb T G 12: 76,604,194 D1669A probably damaging Het
Sptlc2 A G 12: 87,314,049 probably null Het
Synpo2 A G 3: 123,114,041 V542A probably damaging Het
Tecpr2 T C 12: 110,915,480 probably null Het
Tenm2 T C 11: 36,069,414 T1029A probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Tnfaip8l1 C A 17: 56,171,897 N62K probably damaging Het
Tollip A G 7: 141,889,597 S174P probably benign Het
Trp53tg5 A G 2: 164,471,107 I216T possibly damaging Het
Tssk5 A G 15: 76,374,513 S58P probably benign Het
Ttc9b T C 7: 27,654,959 Y157H probably damaging Het
Tuba8 A G 6: 121,222,912 Y185C probably damaging Het
Ubr2 C T 17: 46,955,845 A1127T probably damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Yipf3 T A 17: 46,248,929 L57Q possibly damaging Het
Zbtb32 A C 7: 30,590,181 C19G probably damaging Het
Zfp735 A T 11: 73,712,153 H641L possibly damaging Het
Zfyve28 A T 5: 34,232,227 Y210N probably damaging Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7071:Cc2d2a UTSW 5 43709113 missense probably benign 0.13
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCTCCTGTAATCATATACATCCCATG -3'
(R):5'- AGAAGTCCTCATTGCAGTAAAACAG -3'

Sequencing Primer
(F):5'- TCCCATGTATTTCTTTTTGAAGTTTG -3'
(R):5'- GCAGTAAAACAGTTTGACTCCTTCC -3'
Posted On2019-09-13