Incidental Mutation 'R0646:Med13'
ID57181
Institutional Source Beutler Lab
Gene Symbol Med13
Ensembl Gene ENSMUSG00000034297
Gene Namemediator complex subunit 13
SynonymsThrap1, 1110067M05Rik, Trap240
MMRRC Submission 038831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0646 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86267033-86357602 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86331089 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 238 (Q238L)
Ref Sequence ENSEMBL: ENSMUSP00000044268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043624]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043624
AA Change: Q238L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000044268
Gene: ENSMUSG00000034297
AA Change: Q238L

DomainStartEndE-ValueType
Pfam:Med13_N 1 384 5e-130 PFAM
low complexity region 438 451 N/A INTRINSIC
low complexity region 531 540 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 984 998 N/A INTRINSIC
low complexity region 1001 1029 N/A INTRINSIC
low complexity region 1463 1476 N/A INTRINSIC
low complexity region 1502 1517 N/A INTRINSIC
low complexity region 1522 1550 N/A INTRINSIC
low complexity region 1559 1570 N/A INTRINSIC
low complexity region 1577 1596 N/A INTRINSIC
Pfam:Med13_C 1637 2161 3.5e-146 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144983
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157605
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 95% (123/130)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the mediator complex (also known as TRAP, SMCC, DRIP, or ARC), a transcriptional coactivator complex thought to be required for the expression of almost all genes. The mediator complex is recruited by transcriptional activators or nuclear receptors to induce gene expression, possibly by interacting with RNA polymerase II and promoting the formation of a transcriptional pre-initiation complex. The product of this gene is proposed to form a sub-complex with MED12, cyclin C, and CDK8 that can negatively regulate transactivation by mediator. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele exhibited in the heart exhibit increased susceptibility to obesity and worsened glucose intolerance when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik C T 11: 23,575,491 R716H probably damaging Het
4930432E11Rik C T 7: 29,561,285 noncoding transcript Het
A430078G23Rik T C 8: 3,386,959 Y250H probably damaging Het
Abcb11 A G 2: 69,285,283 I579T probably damaging Het
Abcc9 T C 6: 142,682,104 N400S probably benign Het
Adarb2 T C 13: 8,731,819 L577P probably damaging Het
Agt A C 8: 124,557,113 N422K probably damaging Het
Ahnak A T 19: 9,013,402 K4017* probably null Het
Akap13 C A 7: 75,747,746 Q2575K probably damaging Het
Aldh3a2 A T 11: 61,253,715 I339K probably damaging Het
Alox15 G T 11: 70,345,624 Y483* probably null Het
Ampd1 A T 3: 103,099,597 I713F probably damaging Het
Amph A T 13: 19,113,116 E344V possibly damaging Het
Arid5b A G 10: 68,096,977 S1032P probably damaging Het
Armc8 C A 9: 99,505,688 L393F probably damaging Het
Bpnt1 A G 1: 185,345,426 probably null Het
Cachd1 G A 4: 100,988,221 R970H probably damaging Het
Cd207 T C 6: 83,675,756 T131A probably benign Het
Cd83 G A 13: 43,797,533 V54I probably benign Het
Cfap43 T C 19: 47,763,676 K1086E probably benign Het
Cfap65 A T 1: 74,902,169 V1837E probably benign Het
Clcnka T A 4: 141,396,606 H89L probably benign Het
Cnga4 T C 7: 105,404,975 I50T possibly damaging Het
Cog5 A G 12: 31,837,359 probably benign Het
Col11a2 T A 17: 34,059,348 probably null Het
Col28a1 T G 6: 8,175,291 I186L possibly damaging Het
Col4a2 T A 8: 11,431,252 M808K probably benign Het
Copb2 A G 9: 98,563,475 probably benign Het
Dbnl G A 11: 5,795,441 probably benign Het
Dbx2 T C 15: 95,654,612 T51A possibly damaging Het
Dcp1a A T 14: 30,502,885 M123L probably damaging Het
Ddx42 T A 11: 106,232,833 F217I probably benign Het
Dlc1 T C 8: 36,858,051 T367A probably benign Het
Dmgdh A T 13: 93,752,355 T834S probably benign Het
Dnah8 T C 17: 30,684,173 S929P probably damaging Het
Dnase1l2 C A 17: 24,441,082 V271L possibly damaging Het
Dsc1 T C 18: 20,096,057 Y392C probably damaging Het
Edn1 T C 13: 42,305,242 probably benign Het
Eps8l3 T C 3: 107,884,810 L351P probably damaging Het
F12 G A 13: 55,422,483 probably benign Het
Fam47e T C 5: 92,578,458 probably benign Het
Fcrl5 C A 3: 87,442,013 Q32K probably benign Het
Fndc1 C T 17: 7,741,673 V1637I possibly damaging Het
Foxg1 G T 12: 49,384,567 probably benign Het
Frrs1 A T 3: 116,902,421 I530F possibly damaging Het
Galnt5 A T 2: 57,999,085 K232N probably benign Het
Ggt5 G A 10: 75,602,648 V68M probably damaging Het
Gm11639 G A 11: 104,720,501 D390N probably benign Het
Gm13084 A C 4: 143,812,585 S113A possibly damaging Het
Gm16519 T C 17: 70,929,106 C17R probably benign Het
Gm17535 A G 9: 3,035,804 Y224C probably null Het
Gm884 T A 11: 103,613,160 K485* probably null Het
Gm9631 T G 11: 121,945,629 D28A probably damaging Het
Gpx2 T C 12: 76,795,313 I21M probably benign Het
H2-Q2 T G 17: 35,345,685 D354E probably damaging Het
Icam2 A T 11: 106,380,891 I71K probably damaging Het
Il12a T C 3: 68,697,890 probably benign Het
Insm2 C G 12: 55,600,440 A323G probably benign Het
Itga1 T C 13: 114,968,299 T1064A probably benign Het
Itgad T A 7: 128,174,004 V11E possibly damaging Het
Kctd15 C T 7: 34,644,881 S115N probably damaging Het
Klra5 A G 6: 129,903,564 W124R probably damaging Het
Kng2 T A 16: 22,987,736 D571V probably benign Het
Kpna6 A T 4: 129,650,790 F380I probably benign Het
Lipo1 A T 19: 33,784,769 Y109* probably null Het
Man2a2 T C 7: 80,363,197 H540R possibly damaging Het
Map2k4 T C 11: 65,712,275 E188G probably damaging Het
Mast4 T C 13: 102,758,744 probably benign Het
Mbtd1 A G 11: 93,905,212 D25G probably damaging Het
Mmachc A G 4: 116,703,654 Y215H probably damaging Het
Mtor T A 4: 148,484,354 Y1110* probably null Het
Nek2 A G 1: 191,822,219 N57D probably damaging Het
Nek7 ACCCC ACCC 1: 138,515,693 probably null Het
Neo1 G T 9: 58,931,034 T489K probably damaging Het
Neu1 T A 17: 34,934,760 Y387N probably damaging Het
Nfasc A T 1: 132,608,438 C586* probably null Het
Nle1 G A 11: 82,904,845 L259F probably damaging Het
Nrde2 G A 12: 100,143,846 Q309* probably null Het
Nufip2 C T 11: 77,686,453 H76Y probably benign Het
Olfr1330 A C 4: 118,893,490 T136P probably damaging Het
Olfr1383 A T 11: 49,524,578 N285I probably damaging Het
Olfr466 A T 13: 65,153,063 I280F probably damaging Het
Olfr584 T C 7: 103,086,151 F206S probably damaging Het
Olfr670 A T 7: 104,959,811 I307N probably benign Het
Olfr731 A T 14: 50,238,639 I82N probably damaging Het
Pcdhb5 A G 18: 37,321,622 T352A probably benign Het
Pcdhb7 A T 18: 37,343,389 D526V probably damaging Het
Phkg1 A T 5: 129,864,553 probably null Het
Plg C T 17: 12,418,736 T744M probably damaging Het
Plxnd1 A C 6: 115,958,699 probably benign Het
Poglut1 A T 16: 38,529,475 I312N probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppt1 A G 4: 122,844,099 M77V probably benign Het
Pramel5 G T 4: 144,271,620 T351N probably damaging Het
Psmb4 G A 3: 94,884,964 R216C probably benign Het
Ptprd T C 4: 76,084,403 T699A probably damaging Het
Retreg3 A T 11: 101,098,629 probably benign Het
Scaper G A 9: 55,758,056 A389V probably damaging Het
Serinc5 G A 13: 92,688,737 D225N possibly damaging Het
Slco1a1 T G 6: 141,925,754 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sod3 A T 5: 52,368,079 D40V probably benign Het
Sorcs3 C A 19: 48,206,295 A39E probably benign Het
Spon1 A T 7: 114,039,821 T761S probably benign Het
Syde2 A G 3: 146,014,249 probably null Het
Synm T A 7: 67,759,168 D154V probably benign Het
Synpo2 T C 3: 123,114,449 E406G probably damaging Het
Tcea3 T A 4: 136,248,071 L8* probably null Het
Tec G A 5: 72,823,497 L33F probably damaging Het
Tex15 T A 8: 33,582,326 S2634T possibly damaging Het
Tg T A 15: 66,729,626 Y162N probably damaging Het
Tmem8b G A 4: 43,690,123 V853I probably benign Het
Togaram1 A G 12: 65,021,466 K1748E probably damaging Het
Ttn T C 2: 76,898,478 probably benign Het
Usp36 C T 11: 118,273,021 D234N probably damaging Het
Usp40 G A 1: 87,978,522 P664S probably benign Het
Vmn1r54 T A 6: 90,269,653 L183H probably benign Het
Vmn1r58 T G 7: 5,410,677 I185L probably benign Het
Wnt8a A T 18: 34,547,565 R328W probably benign Het
Yars A G 4: 129,213,939 probably benign Het
Zbtb49 A C 5: 38,200,674 M745R probably damaging Het
Zeb1 T G 18: 5,759,027 F162V probably damaging Het
Zfp369 A T 13: 65,297,548 H835L probably damaging Het
Zic5 A G 14: 122,463,939 V460A unknown Het
Zp3 A G 5: 135,984,356 N181D possibly damaging Het
Other mutations in Med13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Med13 APN 11 86291040 splice site probably benign
IGL01391:Med13 APN 11 86328497 missense probably benign
IGL01767:Med13 APN 11 86319783 missense probably benign 0.38
IGL01830:Med13 APN 11 86288928 splice site probably benign
IGL01859:Med13 APN 11 86283751 missense possibly damaging 0.86
IGL01924:Med13 APN 11 86308696 splice site probably benign
IGL02080:Med13 APN 11 86283812 missense probably damaging 0.97
IGL02138:Med13 APN 11 86286765 missense probably damaging 0.99
IGL02259:Med13 APN 11 86357501 missense possibly damaging 0.89
IGL02339:Med13 APN 11 86288939 missense probably benign 0.16
IGL02399:Med13 APN 11 86283945 splice site probably benign
IGL02646:Med13 APN 11 86283386 missense probably benign 0.00
IGL03227:Med13 APN 11 86327792 splice site probably benign
R0116:Med13 UTSW 11 86319897 missense probably damaging 0.99
R0189:Med13 UTSW 11 86319876 missense probably benign
R0197:Med13 UTSW 11 86307038 missense probably benign 0.13
R0206:Med13 UTSW 11 86300856 splice site probably benign
R0208:Med13 UTSW 11 86300856 splice site probably benign
R0310:Med13 UTSW 11 86346003 missense probably benign 0.11
R0360:Med13 UTSW 11 86329161 splice site probably benign
R0413:Med13 UTSW 11 86299207 splice site probably benign
R0482:Med13 UTSW 11 86285151 missense probably benign 0.41
R0497:Med13 UTSW 11 86276983 splice site probably benign
R0589:Med13 UTSW 11 86283249 missense probably damaging 1.00
R0601:Med13 UTSW 11 86345962 missense possibly damaging 0.47
R0701:Med13 UTSW 11 86307038 missense probably benign 0.13
R0709:Med13 UTSW 11 86319596 missense possibly damaging 0.95
R0711:Med13 UTSW 11 86301353 splice site probably benign
R0734:Med13 UTSW 11 86301237 missense probably benign
R0883:Med13 UTSW 11 86307038 missense probably benign 0.13
R1793:Med13 UTSW 11 86329351 missense probably benign 0.45
R1926:Med13 UTSW 11 86289073 missense possibly damaging 0.47
R1959:Med13 UTSW 11 86298979 missense probably damaging 1.00
R2286:Med13 UTSW 11 86319689 missense probably benign 0.05
R2359:Med13 UTSW 11 86291035 splice site probably benign
R2444:Med13 UTSW 11 86331960 missense probably damaging 1.00
R2679:Med13 UTSW 11 86298577 missense probably benign 0.00
R2879:Med13 UTSW 11 86299162 missense possibly damaging 0.61
R3439:Med13 UTSW 11 86285297 missense probably damaging 1.00
R3735:Med13 UTSW 11 86279658 missense probably benign 0.00
R4333:Med13 UTSW 11 86288183 missense probably benign
R4558:Med13 UTSW 11 86299054 missense probably damaging 1.00
R4598:Med13 UTSW 11 86278566 missense probably damaging 0.97
R4773:Med13 UTSW 11 86276920 missense probably damaging 0.99
R4801:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4802:Med13 UTSW 11 86278773 missense probably damaging 1.00
R4806:Med13 UTSW 11 86298577 missense probably benign 0.00
R4940:Med13 UTSW 11 86288118 missense probably damaging 1.00
R4974:Med13 UTSW 11 86298847 missense probably damaging 0.98
R5056:Med13 UTSW 11 86328565 missense probably benign 0.00
R5133:Med13 UTSW 11 86319849 missense probably benign 0.32
R5206:Med13 UTSW 11 86319879 missense probably damaging 1.00
R5352:Med13 UTSW 11 86301468 missense possibly damaging 0.82
R5534:Med13 UTSW 11 86319365 missense probably benign 0.09
R5556:Med13 UTSW 11 86327838 missense probably benign 0.25
R5633:Med13 UTSW 11 86278931 splice site probably benign
R5769:Med13 UTSW 11 86346003 missense probably benign 0.11
R6236:Med13 UTSW 11 86328531 missense probably damaging 0.99
R6479:Med13 UTSW 11 86357527 start gained probably benign
R6487:Med13 UTSW 11 86331150 missense probably damaging 1.00
R6524:Med13 UTSW 11 86301467 missense probably damaging 0.98
R6528:Med13 UTSW 11 86298954 missense probably damaging 1.00
R6805:Med13 UTSW 11 86278796 missense possibly damaging 0.48
R6913:Med13 UTSW 11 86319876 missense probably benign
R7221:Med13 UTSW 11 86288095 missense probably benign 0.00
R7254:Med13 UTSW 11 86319835 missense probably benign
R7267:Med13 UTSW 11 86308826 missense probably benign 0.01
R7309:Med13 UTSW 11 86291062 missense probably benign 0.00
R7404:Med13 UTSW 11 86286446 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- ACTGAATGCCAAGAGAGCGGTTTG -3'
(R):5'- TGTTTAGCATAGCTACCCAGGGGAAC -3'

Sequencing Primer
(F):5'- CCAAGAGAGCGGTTTGTTATTTAG -3'
(R):5'- TTTCTTCAAGTTGCTTAGAGTCAG -3'
Posted On2013-07-11