Incidental Mutation 'R7367:Hsd17b4'
ID571905
Institutional Source Beutler Lab
Gene Symbol Hsd17b4
Ensembl Gene ENSMUSG00000024507
Gene Namehydroxysteroid (17-beta) dehydrogenase 4
SynonymsD-bifunctional protein, MFP2, multifunctional protein 2, 17[b]-HSD, Mfp-2, perMFE-2, MFE-2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R7367 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location50128201-50196269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50155185 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 227 (H227Q)
Ref Sequence ENSEMBL: ENSMUSP00000025385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025385]
Predicted Effect probably damaging
Transcript: ENSMUST00000025385
AA Change: H227Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025385
Gene: ENSMUSG00000024507
AA Change: H227Q

DomainStartEndE-ValueType
Pfam:KR 10 186 2.1e-17 PFAM
Pfam:adh_short 10 208 2.3e-39 PFAM
Pfam:MaoC_dehydrat_N 346 451 1.4e-8 PFAM
low complexity region 458 470 N/A INTRINSIC
Pfam:MaoC_dehydratas 479 600 1.8e-41 PFAM
Pfam:SCP2 627 730 8.4e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that is involved in the peroxisomal beta-oxidation pathway for fatty acids. It also acts as a catalyst for the formation of 3-ketoacyl-CoA intermediates from both straight-chain and 2-methyl-branched-chain fatty acids. Defects in this gene that affect the peroxisomal fatty acid beta-oxidation activity are a cause of D-bifunctional protein deficiency (DBPD). An apparent pseudogene of this gene is present on chromosome 8. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in fatty acid metabolism, retarded growth, abnormal bile salt composition, impaired coordination, demyelination and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 A G 3: 138,290,551 T374A probably benign Het
Agps T A 2: 75,868,313 H348Q possibly damaging Het
Als2cr12 A T 1: 58,666,864 I282N probably benign Het
Ankrd34b C A 13: 92,438,287 T9K probably benign Het
Atp10b A G 11: 43,247,501 Q1203R probably damaging Het
B4galnt4 A G 7: 141,064,475 N123D probably damaging Het
C530008M17Rik T A 5: 76,856,602 L270Q unknown Het
Cep250 A G 2: 155,969,307 T358A probably benign Het
Cfh A T 1: 140,086,521 H1188Q probably damaging Het
Cisd1 A G 10: 71,336,360 Y31H probably damaging Het
Cnga1 G A 5: 72,605,358 S271F possibly damaging Het
Cntnap5a A G 1: 116,442,295 T881A probably benign Het
Cyp2s1 A T 7: 25,805,973 D355E possibly damaging Het
Dnah11 T A 12: 117,987,442 R3044W possibly damaging Het
Dnah17 T C 11: 118,115,196 D730G probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fsd2 A G 7: 81,535,180 I656T probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gm45871 A T 18: 90,591,100 H154L probably benign Het
Golgb1 T A 16: 36,898,546 N312K probably benign Het
Hist1h2ab A G 13: 23,751,350 D73G possibly damaging Het
Hsd17b6 A T 10: 127,993,623 S237T probably benign Het
Htra4 A T 8: 25,033,697 V284E probably damaging Het
Kcnv1 C T 15: 45,109,242 C415Y probably damaging Het
Kif11 T A 19: 37,420,341 L1037H probably benign Het
Lama5 T C 2: 180,192,958 T1347A probably benign Het
Lrrc32 G T 7: 98,498,879 E289* probably null Het
Lrrc66 T C 5: 73,608,381 T440A probably benign Het
Neurl4 T C 11: 69,908,582 L928P probably damaging Het
Nos2 G A 11: 78,950,090 C788Y possibly damaging Het
Olfr1030 T C 2: 85,984,343 W168R possibly damaging Het
Olfr1265 A G 2: 90,037,812 S298G probably benign Het
Olfr15 A G 16: 3,839,302 T110A probably damaging Het
Pafah1b3 A G 7: 25,296,066 C156R probably benign Het
Pak1ip1 T G 13: 41,008,895 N151K probably damaging Het
Pax7 G A 4: 139,779,749 P326S probably benign Het
Pex11b G A 3: 96,636,678 A21T probably damaging Het
Pkn2 A G 3: 142,810,727 V546A probably benign Het
Ppat T A 5: 76,919,864 R260* probably null Het
Ppp1r13l C G 7: 19,370,156 S187R probably benign Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
R3hdm1 A G 1: 128,153,392 D55G possibly damaging Het
Rev1 A T 1: 38,074,407 Y526* probably null Het
Rp1 A G 1: 4,347,998 W964R probably benign Het
Sarnp A G 10: 128,833,378 I35V probably damaging Het
Sec23a T C 12: 58,966,999 N730S probably benign Het
Sh3d19 A G 3: 86,104,228 K374E probably benign Het
Sh3tc2 A G 18: 61,989,506 D446G probably benign Het
Sugct T A 13: 17,644,814 I149F probably damaging Het
Tle2 A G 10: 81,580,318 N142S probably damaging Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Trpm1 T A 7: 64,268,801 Y1514N probably benign Het
Ubr4 C T 4: 139,452,691 S259L unknown Het
Utp20 A T 10: 88,795,443 L892Q probably benign Het
Wdr92 A G 11: 17,232,712 Y291C probably damaging Het
Wisp3 A G 10: 39,158,265 C114R probably damaging Het
Zfp956 C T 6: 47,963,919 T404M probably damaging Het
Other mutations in Hsd17b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00646:Hsd17b4 APN 18 50164845 missense probably benign
IGL01369:Hsd17b4 APN 18 50172033 missense possibly damaging 0.95
IGL01411:Hsd17b4 APN 18 50191814 missense probably damaging 1.00
IGL01986:Hsd17b4 APN 18 50160126 splice site probably benign
IGL02126:Hsd17b4 APN 18 50181996 missense probably benign
IGL02496:Hsd17b4 APN 18 50155153 missense probably damaging 0.97
IGL02527:Hsd17b4 APN 18 50160164 missense probably benign 0.00
IGL02553:Hsd17b4 APN 18 50162097 splice site probably benign
IGL02813:Hsd17b4 APN 18 50128348 utr 5 prime probably benign
I0000:Hsd17b4 UTSW 18 50160228 missense probably benign 0.09
IGL02980:Hsd17b4 UTSW 18 50146518 missense probably benign 0.06
R0352:Hsd17b4 UTSW 18 50191784 missense probably benign
R0734:Hsd17b4 UTSW 18 50170777 missense possibly damaging 0.90
R0967:Hsd17b4 UTSW 18 50183261 missense probably benign 0.00
R1418:Hsd17b4 UTSW 18 50130187 splice site probably benign
R1661:Hsd17b4 UTSW 18 50160215 missense probably benign
R1665:Hsd17b4 UTSW 18 50160215 missense probably benign
R1752:Hsd17b4 UTSW 18 50170767 missense probably benign 0.27
R1804:Hsd17b4 UTSW 18 50177984 missense probably damaging 1.00
R2197:Hsd17b4 UTSW 18 50183302 splice site probably null
R4351:Hsd17b4 UTSW 18 50142634 missense probably damaging 1.00
R4405:Hsd17b4 UTSW 18 50128314 start gained probably benign
R4976:Hsd17b4 UTSW 18 50160135 missense probably damaging 1.00
R5788:Hsd17b4 UTSW 18 50173709 missense probably damaging 0.99
R5826:Hsd17b4 UTSW 18 50183172 missense probably benign 0.00
R5889:Hsd17b4 UTSW 18 50177209 missense probably damaging 1.00
R6475:Hsd17b4 UTSW 18 50172262 intron probably null
R6632:Hsd17b4 UTSW 18 50179102 missense possibly damaging 0.70
R7151:Hsd17b4 UTSW 18 50128370 missense probably damaging 1.00
R7383:Hsd17b4 UTSW 18 50164850 missense probably benign 0.13
R7397:Hsd17b4 UTSW 18 50146424 missense probably damaging 1.00
R7509:Hsd17b4 UTSW 18 50164682 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGGGATGAAAATGTTCTAAAGCC -3'
(R):5'- AGCCAACATTGTACTTAGGGG -3'

Sequencing Primer
(F):5'- TGAAAATGTTCTAAAGCCTTTTAAGC -3'
(R):5'- GCTGGGATAACAGTGTATACCTCC -3'
Posted On2019-09-13