Incidental Mutation 'R7368:Nol8'
ID571950
Institutional Source Beutler Lab
Gene Symbol Nol8
Ensembl Gene ENSMUSG00000021392
Gene Namenucleolar protein 8
Synonyms5730412B09Rik, D13Ertd548e, 4921532D18Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7368 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location49653078-49679016 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49661219 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 268 (S268P)
Ref Sequence ENSEMBL: ENSMUSP00000152536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021824] [ENSMUST00000221083] [ENSMUST00000221142] [ENSMUST00000222197] [ENSMUST00000222333] [ENSMUST00000223264] [ENSMUST00000223467]
Predicted Effect probably benign
Transcript: ENSMUST00000021824
AA Change: S268P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021824
Gene: ENSMUSG00000021392
AA Change: S268P

DomainStartEndE-ValueType
RRM 27 103 3.02e-9 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 454 468 N/A INTRINSIC
low complexity region 712 724 N/A INTRINSIC
low complexity region 804 816 N/A INTRINSIC
low complexity region 836 849 N/A INTRINSIC
coiled coil region 886 916 N/A INTRINSIC
coiled coil region 955 981 N/A INTRINSIC
low complexity region 1080 1093 N/A INTRINSIC
low complexity region 1152 1164 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221083
Predicted Effect probably benign
Transcript: ENSMUST00000221142
AA Change: S250P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000222197
AA Change: S268P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000222333
Predicted Effect probably benign
Transcript: ENSMUST00000223264
Predicted Effect probably benign
Transcript: ENSMUST00000223467
AA Change: S250P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NOL8 binds Ras-related GTP-binding proteins (see MIM 608267) and plays a role in cell growth (Sekiguchi et al., 2004 [PubMed 14660641]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 A T 12: 84,612,865 F153I possibly damaging Het
Adcy1 G A 11: 7,144,765 V564I probably damaging Het
Apol9b T C 15: 77,735,934 I310T possibly damaging Het
Arhgef28 C A 13: 97,996,862 V366F probably benign Het
B020004C17Rik C T 14: 57,017,316 T199I possibly damaging Het
Carmil2 C T 8: 105,690,835 T575I possibly damaging Het
Catsper1 A T 19: 5,336,663 Q308L unknown Het
Cpa2 T A 6: 30,551,990 S239T probably damaging Het
Ddit3 G A 10: 127,295,907 G108D probably damaging Het
Dnah3 T C 7: 120,029,016 I1473V probably benign Het
Dscam A G 16: 96,643,931 V1520A probably benign Het
Edc4 TAGTAGCAGCAGCAGTAGCAGCAGCAG TAGTAGCAGCAGCAG 8: 105,888,405 probably benign Het
Ednrb T A 14: 103,820,017 I370F probably benign Het
Ehd3 A G 17: 73,827,462 E272G possibly damaging Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Fkbp11 T C 15: 98,724,426 K189E unknown Het
Frem1 T A 4: 82,966,144 E1190D probably benign Het
Gabrg2 A C 11: 41,976,563 Y76* probably null Het
Gm11437 T A 11: 84,167,472 probably benign Het
Gm8947 C A 1: 151,193,096 Q227K probably benign Het
Gm9195 A G 14: 72,480,056 F279S probably damaging Het
Gpbp1l1 T C 4: 116,573,458 I42T probably benign Het
Hdac5 A T 11: 102,197,381 V939E probably null Het
Hivep3 CGG CG 4: 120,097,911 probably null Het
Kitl A T 10: 100,016,081 I21F probably benign Het
Krt1 T C 15: 101,846,872 D484G probably damaging Het
Larp1 C A 11: 58,048,078 P527T probably damaging Het
Lrp5 A G 19: 3,620,085 V673A possibly damaging Het
Lrp6 G T 6: 134,450,818 P1604T probably damaging Het
Mmp27 G A 9: 7,577,317 V228M probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myt1 A G 2: 181,782,591 K26E possibly damaging Het
Nek1 T A 8: 61,089,707 I777N probably benign Het
Nlrc5 C T 8: 94,476,393 R374* probably null Het
Nynrin T A 14: 55,870,511 L1025Q probably damaging Het
Olfr1099 A G 2: 86,959,258 S67P probably damaging Het
Osbpl3 A T 6: 50,348,098 L140H probably damaging Het
Pcnt T C 10: 76,400,001 N1382S probably benign Het
Pef1 T A 4: 130,127,385 L244* probably null Het
Phf11a T C 14: 59,280,725 E191G probably benign Het
Polr3a A T 14: 24,467,076 D702E probably damaging Het
Ptch1 C T 13: 63,511,984 G1285D probably benign Het
Ptpn3 T C 4: 57,221,993 D566G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Scgb1b12 T C 7: 32,334,567 I84T probably damaging Het
Sh2b1 A T 7: 126,468,513 D618E possibly damaging Het
Slc35f5 T A 1: 125,584,519 V352E probably damaging Het
Sppl2c A G 11: 104,187,604 E410G probably damaging Het
St6galnac2 T C 11: 116,679,979 Y261C probably damaging Het
Stra6 G A 9: 58,151,260 R468Q probably benign Het
Taf3 T C 2: 9,916,377 H924R unknown Het
Tbx18 C A 9: 87,730,697 V50L probably benign Het
Tgoln1 G C 6: 72,616,278 T73R probably benign Het
Unc45b C T 11: 82,942,495 T845I probably benign Het
Usp15 T C 10: 123,196,893 D8G possibly damaging Het
Vmn2r91 A G 17: 18,136,278 I736V possibly damaging Het
Vps13c C A 9: 67,914,073 D1288E probably benign Het
Zfp458 T A 13: 67,257,236 M380L probably benign Het
Zfp638 A G 6: 83,929,455 N201D possibly damaging Het
Other mutations in Nol8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Nol8 APN 13 49662228 missense probably benign 0.01
IGL01106:Nol8 APN 13 49654481 missense possibly damaging 0.46
IGL01413:Nol8 APN 13 49659952 missense possibly damaging 0.82
IGL01540:Nol8 APN 13 49661670 missense probably benign 0.06
IGL01670:Nol8 APN 13 49661308 missense possibly damaging 0.54
IGL01672:Nol8 APN 13 49675407 missense possibly damaging 0.95
IGL02032:Nol8 APN 13 49672772 missense probably benign
IGL02212:Nol8 APN 13 49662150 missense possibly damaging 0.87
IGL02323:Nol8 APN 13 49655245 splice site probably benign
IGL02645:Nol8 APN 13 49665471 critical splice donor site probably null
IGL02949:Nol8 APN 13 49662402 missense probably benign 0.01
IGL02954:Nol8 APN 13 49661172 missense probably benign 0.01
IGL03182:Nol8 APN 13 49664081 missense probably damaging 1.00
IGL03406:Nol8 APN 13 49661568 missense probably damaging 1.00
P0047:Nol8 UTSW 13 49654348 splice site probably null
R0092:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0099:Nol8 UTSW 13 49672689 missense probably benign
R0145:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0269:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0370:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0374:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R0390:Nol8 UTSW 13 49662152 missense probably damaging 1.00
R0617:Nol8 UTSW 13 49654445 missense possibly damaging 0.49
R0635:Nol8 UTSW 13 49676758 missense probably benign 0.05
R0637:Nol8 UTSW 13 49662447 missense possibly damaging 0.54
R1246:Nol8 UTSW 13 49676769 missense probably damaging 1.00
R1446:Nol8 UTSW 13 49655227 missense probably damaging 1.00
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1464:Nol8 UTSW 13 49676788 missense probably benign
R1627:Nol8 UTSW 13 49661504 missense probably benign 0.01
R1703:Nol8 UTSW 13 49667457 missense possibly damaging 0.65
R1751:Nol8 UTSW 13 49667408 missense probably benign 0.06
R2187:Nol8 UTSW 13 49661999 missense probably benign 0.00
R2357:Nol8 UTSW 13 49654504 critical splice donor site probably null
R3081:Nol8 UTSW 13 49678392 unclassified probably benign
R3969:Nol8 UTSW 13 49660016 nonsense probably null
R4199:Nol8 UTSW 13 49661748 missense possibly damaging 0.65
R4720:Nol8 UTSW 13 49662753 missense probably damaging 1.00
R4927:Nol8 UTSW 13 49654425 missense possibly damaging 0.79
R5177:Nol8 UTSW 13 49661112 missense probably benign 0.32
R5512:Nol8 UTSW 13 49676787 missense probably benign
R5744:Nol8 UTSW 13 49662326 missense possibly damaging 0.82
R5988:Nol8 UTSW 13 49672614 missense possibly damaging 0.58
R6048:Nol8 UTSW 13 49653684 critical splice donor site probably null
R6306:Nol8 UTSW 13 49676353 missense probably damaging 1.00
R6359:Nol8 UTSW 13 49664070 missense probably benign 0.16
R6378:Nol8 UTSW 13 49667355 missense probably damaging 1.00
R6655:Nol8 UTSW 13 49654392 missense probably damaging 1.00
R7035:Nol8 UTSW 13 49661202 missense probably benign 0.06
R7058:Nol8 UTSW 13 49676386 missense probably damaging 1.00
R7450:Nol8 UTSW 13 49660015 missense probably benign 0.01
X0020:Nol8 UTSW 13 49661165 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTCACTTGGGAATTGGAAGG -3'
(R):5'- GAATGCCCAGGTTTCTCTCTG -3'

Sequencing Primer
(F):5'- TTGGAAGGAGGCAATGACCCTATG -3'
(R):5'- AATTCATCTTCCGAGTCAACATCATC -3'
Posted On2019-09-13