Incidental Mutation 'R7369:Car5a'
ID572006
Institutional Source Beutler Lab
Gene Symbol Car5a
Ensembl Gene ENSMUSG00000025317
Gene Namecarbonic anhydrase 5a, mitochondrial
SynonymsCar5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R7369 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location121916126-121944904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121923834 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 157 (K157R)
Ref Sequence ENSEMBL: ENSMUSP00000060457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057653] [ENSMUST00000127664]
PDB Structure
MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AT 2.45 ANGSTROMS RESOLUTION [X-RAY DIFFRACTION]
COMPLEX BETWEEN MURINE MITOCHONDRIAL CARBONIC ANYHDRASE V AND THE TRANSITION STATE ANALOGUE ACETAZOLAMIDE [X-RAY DIFFRACTION]
Crystal Structure of F65A/Y131C Carbonic Anhydrase V, covalently modified with 4-chloromethylimidazole [X-RAY DIFFRACTION]
MURINE CARBONIC ANHYDRASE V [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000057653
AA Change: K157R

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000060457
Gene: ENSMUSG00000025317
AA Change: K157R

DomainStartEndE-ValueType
Carb_anhydrase 27 290 6.61e-125 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. CA VA is localized in the mitochondria and expressed primarily in the liver. It may play an important role in ureagenesis and gluconeogenesis. CA5A gene maps to chromosome 16q24.3 and an unprocessed pseudogene has been assigned to 16p12-p11.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body size, hyperammonemia, and increased levels of urinary metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Car5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01890:Car5a APN 8 121923610 missense probably benign 0.07
IGL01972:Car5a APN 8 121927082 critical splice donor site probably null
R0152:Car5a UTSW 8 121916446 missense probably damaging 1.00
R0562:Car5a UTSW 8 121944730 missense probably benign 0.00
R0699:Car5a UTSW 8 121944816 unclassified probably benign
R1827:Car5a UTSW 8 121923808 missense probably benign 0.00
R2274:Car5a UTSW 8 121944669 critical splice donor site probably null
R4261:Car5a UTSW 8 121944749 missense probably benign 0.03
R5436:Car5a UTSW 8 121917242 intron probably benign
R5869:Car5a UTSW 8 121916380 missense probably benign
R5937:Car5a UTSW 8 121939821 missense probably damaging 1.00
R6388:Car5a UTSW 8 121927171 missense probably damaging 1.00
R6803:Car5a UTSW 8 121923765 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAACACACTGTGCTCGCAA -3'
(R):5'- GGGATTGAACACAGGCCAA -3'

Sequencing Primer
(F):5'- TCGCAAGAGGGGCAGTGTG -3'
(R):5'- AACGGTACCTTTGAACCGTG -3'
Posted On2019-09-13