Incidental Mutation 'R7369:Dsp'
ID572028
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Namedesmoplakin
Synonyms5730453H04Rik, DP, 2300002E22Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7369 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location38151294-38198577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38197525 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 2749 (V2749F)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124830
AA Change: V2749F

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: V2749F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127906
AA Change: V2150F

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: V2150F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38197846 missense probably damaging 0.99
IGL01337:Dsp APN 13 38192687 missense probably benign 0.44
IGL01371:Dsp APN 13 38193617 missense probably benign 0.13
IGL01473:Dsp APN 13 38167571 missense probably damaging 0.99
IGL01660:Dsp APN 13 38176495 missense possibly damaging 0.90
IGL01723:Dsp APN 13 38179084 missense probably damaging 1.00
IGL01999:Dsp APN 13 38181186 missense probably damaging 0.99
IGL02313:Dsp APN 13 38196523 nonsense probably null
IGL02833:Dsp APN 13 38192921 missense possibly damaging 0.56
IGL03050:Dsp APN 13 38188445 splice site probably benign
IGL03353:Dsp APN 13 38186695 missense probably damaging 1.00
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0078:Dsp UTSW 13 38196017 missense probably benign 0.22
R0230:Dsp UTSW 13 38197705 missense probably benign 0.03
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0285:Dsp UTSW 13 38172794 missense probably benign
R0326:Dsp UTSW 13 38192870 nonsense probably null
R0332:Dsp UTSW 13 38182228 nonsense probably null
R0471:Dsp UTSW 13 38193350 nonsense probably null
R0567:Dsp UTSW 13 38192438 missense probably benign 0.01
R0611:Dsp UTSW 13 38187741 missense probably damaging 1.00
R0718:Dsp UTSW 13 38196764 missense possibly damaging 0.80
R0926:Dsp UTSW 13 38183218 missense probably damaging 0.97
R1078:Dsp UTSW 13 38183106 splice site probably benign
R1183:Dsp UTSW 13 38191740 nonsense probably null
R1188:Dsp UTSW 13 38194963 missense probably damaging 1.00
R1419:Dsp UTSW 13 38186695 missense probably damaging 1.00
R1445:Dsp UTSW 13 38191931 missense probably damaging 0.98
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1478:Dsp UTSW 13 38181138 missense probably damaging 1.00
R1568:Dsp UTSW 13 38175147 missense probably damaging 1.00
R1572:Dsp UTSW 13 38195738 missense probably damaging 1.00
R1676:Dsp UTSW 13 38193374 nonsense probably null
R1736:Dsp UTSW 13 38192990 missense probably benign 0.01
R1776:Dsp UTSW 13 38196617 missense probably damaging 0.99
R1829:Dsp UTSW 13 38193195 missense probably damaging 1.00
R1878:Dsp UTSW 13 38164855 missense possibly damaging 0.53
R2013:Dsp UTSW 13 38191458 missense probably damaging 1.00
R2161:Dsp UTSW 13 38196451 missense probably damaging 1.00
R2187:Dsp UTSW 13 38176407 missense probably damaging 1.00
R2295:Dsp UTSW 13 38197046 missense probably benign 0.28
R2495:Dsp UTSW 13 38193477 missense possibly damaging 0.91
R2566:Dsp UTSW 13 38196404 missense probably damaging 1.00
R2888:Dsp UTSW 13 38192248 missense possibly damaging 0.92
R3012:Dsp UTSW 13 38193342 missense possibly damaging 0.61
R3614:Dsp UTSW 13 38177199 missense probably damaging 0.98
R3725:Dsp UTSW 13 38194689 splice site probably null
R3725:Dsp UTSW 13 38197618 missense probably benign 0.00
R3797:Dsp UTSW 13 38177284 critical splice donor site probably null
R3841:Dsp UTSW 13 38197705 missense probably benign
R4030:Dsp UTSW 13 38191428 missense possibly damaging 0.84
R4124:Dsp UTSW 13 38186713 missense probably damaging 1.00
R4279:Dsp UTSW 13 38185231 missense probably damaging 1.00
R4334:Dsp UTSW 13 38196664 missense possibly damaging 0.46
R4419:Dsp UTSW 13 38195132 missense probably damaging 1.00
R4615:Dsp UTSW 13 38191632 missense probably damaging 0.98
R4627:Dsp UTSW 13 38168641 missense probably benign 0.01
R4639:Dsp UTSW 13 38196784 missense probably damaging 1.00
R4687:Dsp UTSW 13 38191619 missense probably damaging 1.00
R4735:Dsp UTSW 13 38196040 missense probably damaging 0.99
R4746:Dsp UTSW 13 38195104 missense possibly damaging 0.51
R4772:Dsp UTSW 13 38167528 nonsense probably null
R4830:Dsp UTSW 13 38192864 missense probably benign
R4850:Dsp UTSW 13 38192469 missense probably damaging 1.00
R4959:Dsp UTSW 13 38191710 missense probably benign 0.41
R4963:Dsp UTSW 13 38197870 missense probably damaging 0.99
R4969:Dsp UTSW 13 38192910 missense probably benign 0.00
R4978:Dsp UTSW 13 38182234 missense probably damaging 1.00
R4989:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5068:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5069:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5070:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5133:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5138:Dsp UTSW 13 38183298 missense probably benign 0.37
R5138:Dsp UTSW 13 38195845 missense possibly damaging 0.50
R5153:Dsp UTSW 13 38182306 missense probably damaging 1.00
R5199:Dsp UTSW 13 38192902 nonsense probably null
R5226:Dsp UTSW 13 38186770 missense probably damaging 0.99
R5265:Dsp UTSW 13 38195183 missense possibly damaging 0.95
R5371:Dsp UTSW 13 38194889 missense probably damaging 0.97
R5484:Dsp UTSW 13 38184038 missense possibly damaging 0.48
R5534:Dsp UTSW 13 38195842 missense probably benign 0.01
R5569:Dsp UTSW 13 38192652 missense probably benign 0.01
R5854:Dsp UTSW 13 38167501 splice site probably null
R5910:Dsp UTSW 13 38192469 missense possibly damaging 0.95
R5929:Dsp UTSW 13 38195434 missense possibly damaging 0.92
R5940:Dsp UTSW 13 38196026 missense possibly damaging 0.70
R5948:Dsp UTSW 13 38195401 missense possibly damaging 0.95
R5955:Dsp UTSW 13 38194958 missense possibly damaging 0.73
R5970:Dsp UTSW 13 38195702 missense possibly damaging 0.93
R6054:Dsp UTSW 13 38167609 missense probably benign 0.00
R6113:Dsp UTSW 13 38192047 missense probably damaging 1.00
R6139:Dsp UTSW 13 38192406 missense probably damaging 0.97
R6328:Dsp UTSW 13 38197006 nonsense probably null
R6527:Dsp UTSW 13 38195873 missense probably damaging 1.00
R6573:Dsp UTSW 13 38196862 missense probably damaging 1.00
R6628:Dsp UTSW 13 38167622 missense possibly damaging 0.73
R6738:Dsp UTSW 13 38192210 missense possibly damaging 0.87
R6898:Dsp UTSW 13 38192217 missense possibly damaging 0.59
R6919:Dsp UTSW 13 38167655 missense possibly damaging 0.84
R6951:Dsp UTSW 13 38167646 missense possibly damaging 0.95
R7017:Dsp UTSW 13 38186707 missense probably benign 0.02
R7022:Dsp UTSW 13 38191740 missense probably benign 0.06
R7135:Dsp UTSW 13 38179073 missense probably damaging 1.00
R7192:Dsp UTSW 13 38195593 missense probably benign 0.09
R7211:Dsp UTSW 13 38188535 critical splice donor site probably null
R7251:Dsp UTSW 13 38193548 missense probably benign 0.02
R7326:Dsp UTSW 13 38192883 missense probably benign 0.01
R7376:Dsp UTSW 13 38172843 missense probably damaging 1.00
R7406:Dsp UTSW 13 38197196 missense possibly damaging 0.63
R7439:Dsp UTSW 13 38176502 critical splice donor site probably null
R7439:Dsp UTSW 13 38195449 missense probably benign 0.00
R7441:Dsp UTSW 13 38195449 missense probably benign 0.00
R7477:Dsp UTSW 13 38172863 missense probably damaging 1.00
X0023:Dsp UTSW 13 38197684 missense probably benign 0.00
X0024:Dsp UTSW 13 38193255 missense probably benign 0.04
X0027:Dsp UTSW 13 38186646 missense possibly damaging 0.68
X0067:Dsp UTSW 13 38182312 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CATTCACCCTACCACTGGTCAG -3'
(R):5'- CATGGAGCGATTCATGGCATC -3'

Sequencing Primer
(F):5'- AGTCAACCAGGGTCTCATTG -3'
(R):5'- AGCGATTCATGGCATCCTTGTAG -3'
Posted On2019-09-13