Incidental Mutation 'R7372:Trim6'
ID572159
Institutional Source Beutler Lab
Gene Symbol Trim6
Ensembl Gene ENSMUSG00000072244
Gene Nametripartite motif-containing 6
SynonymsC430046K18Rik, D7Ertd684e
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.198) question?
Stock #R7372 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104218793-104235152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 104232636 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 391 (A391S)
Ref Sequence ENSEMBL: ENSMUSP00000095782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098180] [ENSMUST00000214578]
Predicted Effect probably benign
Transcript: ENSMUST00000098180
AA Change: A391S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000095782
Gene: ENSMUSG00000072244
AA Change: A391S

DomainStartEndE-ValueType
RING 15 59 8.16e-10 SMART
BBOX 92 133 8.87e-11 SMART
low complexity region 194 211 N/A INTRINSIC
PRY 300 351 5.31e-9 SMART
Pfam:SPRY 354 482 9.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214578
AA Change: A365S

PolyPhen 2 Score 0.758 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. The protein localizes to the nucleus, but its specific function has not been identified. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from this gene into the downstream TRIM34 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Trim6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00828:Trim6 APN 7 104230743 missense probably benign 0.00
IGL02493:Trim6 APN 7 104232640 missense probably benign 0.04
IGL02517:Trim6 APN 7 104232357 splice site probably benign
R0026:Trim6 UTSW 7 104225809 synonymous probably null
R1505:Trim6 UTSW 7 104232564 missense probably damaging 1.00
R1711:Trim6 UTSW 7 104232837 missense probably damaging 1.00
R2507:Trim6 UTSW 7 104228185 missense probably damaging 1.00
R3919:Trim6 UTSW 7 104232850 missense probably damaging 1.00
R4731:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4732:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4733:Trim6 UTSW 7 104232648 missense probably damaging 1.00
R4858:Trim6 UTSW 7 104232485 nonsense probably null
R5120:Trim6 UTSW 7 104228240 missense probably damaging 1.00
R7147:Trim6 UTSW 7 104225570 missense probably benign 0.00
R7407:Trim6 UTSW 7 104225901 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACACTGAATCCACAGACG -3'
(R):5'- TAAAAGGAGACCGTGCCAGC -3'

Sequencing Primer
(F):5'- CTTGTCCTGTCGAAAAATCGGAGAC -3'
(R):5'- GTGCCAGCCTCACAGTCTAAG -3'
Posted On2019-09-13