Incidental Mutation 'R7373:Dennd4a'
ID572223
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R7373 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 64897269 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1297 (Q1297K)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect probably benign
Transcript: ENSMUST00000038890
AA Change: Q1297K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: Q1297K

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G A 11: 50,795,435 A1027T probably benign Het
Aldh7a1 G A 18: 56,542,317 T260M possibly damaging Het
Anks3 T C 16: 4,955,871 Y187C probably benign Het
Atp2c2 A T 8: 119,730,252 I198F probably benign Het
Bsn T C 9: 108,113,484 T1690A probably damaging Het
Catsper3 T C 13: 55,808,132 I350T possibly damaging Het
Cdcp1 C T 9: 123,177,900 R594H probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cldn1 G T 16: 26,360,856 P154T probably damaging Het
Cntnap5a A T 1: 116,580,637 N1293I probably benign Het
Crybg1 T C 10: 44,004,140 T351A probably benign Het
Csmd1 T C 8: 15,992,713 N2340S probably damaging Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnah8 T C 17: 30,767,965 probably null Het
Dst G T 1: 34,188,391 L1688F probably benign Het
Ehmt1 A G 2: 24,919,573 M1T probably null Het
Fasn A T 11: 120,813,976 L1261Q possibly damaging Het
Fat1 A G 8: 45,026,665 D2916G probably damaging Het
Fgfr3 C A 5: 33,727,690 F49L probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hormad1 A T 3: 95,576,317 T147S probably damaging Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Itgb8 A G 12: 119,202,475 V107A probably benign Het
Kat2a C T 11: 100,708,566 A533T probably benign Het
Kif20b T C 19: 34,935,671 L328P probably damaging Het
Lims1 T C 10: 58,409,620 F157S probably damaging Het
Lrp2 G T 2: 69,500,692 H1673Q probably damaging Het
Lrrc46 C A 11: 97,038,880 M43I probably benign Het
Lrrk2 T C 15: 91,700,004 probably null Het
Meox2 A T 12: 37,108,798 probably benign Het
Mfsd5 T A 15: 102,280,992 F266L probably damaging Het
Miga2 A G 2: 30,382,071 T468A probably damaging Het
Mmel1 T A 4: 154,889,208 L316Q not run Het
Ndufa9 C A 6: 126,834,458 G232C probably damaging Het
Obox2 A T 7: 15,397,220 K84* probably null Het
Olfr1311 T A 2: 112,021,442 R137S probably benign Het
Olfr33 T A 7: 102,714,099 I105F possibly damaging Het
Otogl G T 10: 107,901,251 Q101K probably damaging Het
Pcnx2 C T 8: 125,808,027 V1288M probably damaging Het
Pde10a T A 17: 8,942,992 W220R probably benign Het
Recql5 T C 11: 115,928,372 T123A possibly damaging Het
Rpl28 T C 7: 4,793,603 V61A probably benign Het
Secisbp2l A T 2: 125,757,271 M494K probably damaging Het
Sh3bgr G A 16: 96,205,835 E2K unknown Het
Shcbp1l C A 1: 153,425,240 T6K probably benign Het
Slc22a15 A C 3: 101,877,897 L353R possibly damaging Het
Sqle T C 15: 59,317,809 I100T probably benign Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tll1 A T 8: 64,051,357 N668K probably damaging Het
Tm7sf2 A G 19: 6,066,646 S118P probably benign Het
Tmco5 G T 2: 116,886,745 V169L probably benign Het
Trpv1 A G 11: 73,240,673 K346E probably damaging Het
Ttk G A 9: 83,854,877 R463H probably benign Het
Vmn2r120 G T 17: 57,509,406 L650I probably benign Het
Vmn2r58 C T 7: 41,837,788 C561Y probably damaging Het
Vmn2r-ps117 A T 17: 18,824,686 Q455L probably benign Het
Zfr T A 15: 12,140,559 S231T unknown Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 intron probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4821:Dennd4a UTSW 9 64897249 missense possibly damaging 0.92
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGTCCTTTGACAAGCCG -3'
(R):5'- GCCCACAAACCTACCTTTGATG -3'

Sequencing Primer
(F):5'- CCAGCATTGATTTACAACGAGCATG -3'
(R):5'- CAAACCTACCTTTGATGACGTAGTG -3'
Posted On2019-09-13