Incidental Mutation 'R7374:Usp9y'
ID572303
Institutional Source Beutler Lab
Gene Symbol Usp9y
Ensembl Gene ENSMUSG00000069044
Gene Nameubiquitin specific peptidase 9, Y chromosome
SynonymsDffry, Fafl2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7374 (G1)
Quality Score221.999
Status Not validated
ChromosomeY
Chromosomal Location1298961-1459782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 1381305 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 839 (I839V)
Ref Sequence ENSEMBL: ENSMUSP00000088727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091188]
Predicted Effect probably benign
Transcript: ENSMUST00000091188
AA Change: I839V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088727
Gene: ENSMUSG00000069044
AA Change: I839V

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
low complexity region 286 301 N/A INTRINSIC
low complexity region 973 983 N/A INTRINSIC
low complexity region 1089 1100 N/A INTRINSIC
low complexity region 1352 1363 N/A INTRINSIC
Pfam:UCH 1558 1955 9.2e-53 PFAM
Pfam:UCH_1 1559 1909 4e-22 PFAM
low complexity region 1959 1971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the peptidase C19 family. It encodes a protein that is similar to ubiquitin-specific proteases, which cleave the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Abcd4 A T 12: 84,606,243 L395* probably null Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Cyp2c68 T C 19: 39,739,204 probably null Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gas6 A T 8: 13,474,802 V330D probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Gria2 T C 3: 80,741,076 T118A probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr1061 C A 2: 86,413,852 A67S probably benign Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r68 A T 7: 85,232,399 M491K possibly damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Usp9y
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4466001:Usp9y UTSW Y 1432197 missense probably damaging 0.96
R0288:Usp9y UTSW Y 1333606 splice site probably benign
R0365:Usp9y UTSW Y 1364732 missense probably damaging 1.00
R0386:Usp9y UTSW Y 1316933 missense probably damaging 1.00
R0395:Usp9y UTSW Y 1340053 missense probably damaging 1.00
R0518:Usp9y UTSW Y 1307880 missense probably benign
R0521:Usp9y UTSW Y 1307880 missense probably benign
R0530:Usp9y UTSW Y 1333600 splice site probably benign
R0759:Usp9y UTSW Y 1299097 missense probably damaging 0.99
R0849:Usp9y UTSW Y 1394002 missense probably damaging 1.00
R0932:Usp9y UTSW Y 1315930 missense probably benign 0.37
R1018:Usp9y UTSW Y 1341414 splice site probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1208:Usp9y UTSW Y 1356282 missense probably benign
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1470:Usp9y UTSW Y 1332471 missense probably benign 0.19
R1730:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1743:Usp9y UTSW Y 1316727 missense probably damaging 1.00
R1765:Usp9y UTSW Y 1384454 missense possibly damaging 0.88
R1775:Usp9y UTSW Y 1368089 missense probably damaging 1.00
R1783:Usp9y UTSW Y 1367093 missense probably benign 0.18
R1889:Usp9y UTSW Y 1448829 intron probably null
R1901:Usp9y UTSW Y 1303371 critical splice donor site probably null
R2081:Usp9y UTSW Y 1381277 missense possibly damaging 0.65
R2119:Usp9y UTSW Y 1303451 missense probably benign 0.00
R2357:Usp9y UTSW Y 1394050 missense possibly damaging 0.87
R2873:Usp9y UTSW Y 1310502 splice site probably benign
R3938:Usp9y UTSW Y 1313741 missense probably damaging 0.97
R4323:Usp9y UTSW Y 1434407 missense possibly damaging 0.93
R4385:Usp9y UTSW Y 1304756 missense probably damaging 1.00
R4407:Usp9y UTSW Y 1336375 missense probably benign 0.16
R4457:Usp9y UTSW Y 1394078 missense possibly damaging 0.62
R4747:Usp9y UTSW Y 1391284 missense possibly damaging 0.64
R4823:Usp9y UTSW Y 1444559 missense probably damaging 0.99
R4834:Usp9y UTSW Y 1317002 missense probably benign 0.32
R4872:Usp9y UTSW Y 1307920 missense probably damaging 1.00
R4911:Usp9y UTSW Y 1308041 missense probably damaging 0.96
R4915:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R4962:Usp9y UTSW Y 1384336 missense probably damaging 1.00
R5378:Usp9y UTSW Y 1315928 missense probably damaging 0.99
R5422:Usp9y UTSW Y 1314676 missense probably benign
R5432:Usp9y UTSW Y 1368022 splice site probably null
R5442:Usp9y UTSW Y 1336467 missense possibly damaging 0.80
R5469:Usp9y UTSW Y 1364714 missense probably benign 0.01
R5500:Usp9y UTSW Y 1341875 missense probably damaging 1.00
R5729:Usp9y UTSW Y 1381339 missense probably damaging 0.97
R5891:Usp9y UTSW Y 1341535 missense probably benign 0.05
R5920:Usp9y UTSW Y 1316730 missense probably damaging 1.00
R5948:Usp9y UTSW Y 1324996 missense possibly damaging 0.79
R6062:Usp9y UTSW Y 1454199 missense probably benign 0.28
R6265:Usp9y UTSW Y 1446843 missense probably benign 0.00
R6274:Usp9y UTSW Y 1316735 missense probably damaging 0.99
R6313:Usp9y UTSW Y 1385355 missense probably benign
R6330:Usp9y UTSW Y 1340123 missense probably benign 0.20
R6471:Usp9y UTSW Y 1384511 missense probably damaging 1.00
R6547:Usp9y UTSW Y 1444612 missense probably damaging 0.99
R6791:Usp9y UTSW Y 1325042 splice site probably null
R7194:Usp9y UTSW Y 1304672 missense probably damaging 1.00
R7357:Usp9y UTSW Y 1333656 missense possibly damaging 0.58
R7404:Usp9y UTSW Y 1341780 missense probably benign 0.35
R7481:Usp9y UTSW Y 1432180 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ACTCACAGTTTGCTAAATAACTCTAGG -3'
(R):5'- AGAATATTGAAGAGTTAGTGCTTGG -3'

Sequencing Primer
(F):5'- GGTAGAATCATCCTTTCCTCA -3'
(R):5'- AACTTTGTATGCCCCAGTACAGG -3'
Posted On2019-09-13