Incidental Mutation 'R7375:Col28a1'
ID572328
Institutional Source Beutler Lab
Gene Symbol Col28a1
Ensembl Gene ENSMUSG00000068794
Gene Namecollagen, type XXVIII, alpha 1
SynonymsCol28; Gm466
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7375 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location7997808-8192617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7998499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 1137 (T1137S)
Ref Sequence ENSEMBL: ENSMUSP00000111199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115537]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115537
AA Change: T1137S

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000111199
Gene: ENSMUSG00000068794
AA Change: T1137S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
VWA 46 225 8.08e-18 SMART
low complexity region 245 260 N/A INTRINSIC
internal_repeat_1 261 304 1.56e-15 PROSPERO
low complexity region 306 363 N/A INTRINSIC
low complexity region 375 422 N/A INTRINSIC
low complexity region 438 479 N/A INTRINSIC
internal_repeat_4 481 531 4.11e-8 PROSPERO
Pfam:Collagen 534 591 1.5e-8 PFAM
low complexity region 640 661 N/A INTRINSIC
low complexity region 667 684 N/A INTRINSIC
internal_repeat_4 690 739 4.11e-8 PROSPERO
internal_repeat_1 711 763 1.56e-15 PROSPERO
internal_repeat_5 713 769 4.35e-6 PROSPERO
low complexity region 771 789 N/A INTRINSIC
VWA 796 973 1.57e-38 SMART
KU 1086 1139 8.16e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] COL28A1 belongs to a class of collagens containing von Willebrand factor (VWF; MIM 613160) type A (VWFA) domains (Veit et al., 2006 [PubMed 16330543]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Arhgap5 T A 12: 52,516,582 L112* probably null Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col16a1 A C 4: 130,065,501 K680T unknown Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Pros1 T A 16: 62,924,550 N509K probably damaging Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Tmem81 G T 1: 132,507,563 V36L possibly damaging Het
Trabd2b G T 4: 114,609,997 K474N probably benign Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Col28a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Col28a1 APN 6 8014795 missense probably damaging 1.00
IGL00329:Col28a1 APN 6 8175425 missense probably damaging 1.00
IGL00466:Col28a1 APN 6 8022081 splice site probably benign
IGL00544:Col28a1 APN 6 8162228 critical splice acceptor site probably null
IGL00979:Col28a1 APN 6 8014810 missense probably damaging 1.00
IGL01475:Col28a1 APN 6 8103521 missense probably damaging 0.98
IGL01570:Col28a1 APN 6 8014540 missense probably damaging 0.99
IGL01688:Col28a1 APN 6 7998517 missense probably damaging 1.00
IGL01734:Col28a1 APN 6 8158134 missense probably damaging 0.99
IGL01911:Col28a1 APN 6 8014963 missense probably damaging 1.00
IGL01922:Col28a1 APN 6 8158133 missense probably damaging 0.96
IGL02567:Col28a1 APN 6 8014819 missense possibly damaging 0.91
IGL02641:Col28a1 APN 6 8014794 nonsense probably null
IGL02893:Col28a1 APN 6 8103534 missense probably damaging 1.00
IGL03062:Col28a1 APN 6 8017029 splice site probably benign
IGL03273:Col28a1 APN 6 8103484 splice site probably benign
P0043:Col28a1 UTSW 6 8168152 unclassified probably benign
R0034:Col28a1 UTSW 6 8175708 missense probably benign 0.32
R0543:Col28a1 UTSW 6 8075326 splice site probably benign
R0646:Col28a1 UTSW 6 8175291 missense possibly damaging 0.88
R0726:Col28a1 UTSW 6 8014495 critical splice donor site probably null
R1013:Col28a1 UTSW 6 7999452 splice site probably benign
R1054:Col28a1 UTSW 6 8175534 missense probably damaging 0.96
R1671:Col28a1 UTSW 6 8083773 missense possibly damaging 0.84
R1804:Col28a1 UTSW 6 8164612 critical splice donor site probably null
R1853:Col28a1 UTSW 6 8014574 missense probably benign 0.03
R1906:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R1914:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1915:Col28a1 UTSW 6 8176333 missense probably benign 0.08
R1954:Col28a1 UTSW 6 7998516 missense probably damaging 1.00
R1997:Col28a1 UTSW 6 7999644 missense probably benign 0.14
R2011:Col28a1 UTSW 6 8059360 missense probably benign 0.05
R2023:Col28a1 UTSW 6 8083783 missense possibly damaging 0.66
R2149:Col28a1 UTSW 6 8155383 missense possibly damaging 0.83
R2285:Col28a1 UTSW 6 8097078 missense probably damaging 0.98
R2403:Col28a1 UTSW 6 8175641 missense possibly damaging 0.79
R3615:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3616:Col28a1 UTSW 6 8014942 missense probably damaging 1.00
R3837:Col28a1 UTSW 6 8014601 missense possibly damaging 0.81
R4042:Col28a1 UTSW 6 8014678 missense probably damaging 0.98
R4084:Col28a1 UTSW 6 8013131 nonsense probably null
R4084:Col28a1 UTSW 6 8013132 missense possibly damaging 0.49
R4417:Col28a1 UTSW 6 8175666 missense possibly damaging 0.62
R4838:Col28a1 UTSW 6 8014559 missense probably benign 0.11
R5752:Col28a1 UTSW 6 8015025 missense possibly damaging 0.79
R5807:Col28a1 UTSW 6 8158144 missense probably benign 0.00
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6038:Col28a1 UTSW 6 8013140 missense probably benign 0.03
R6046:Col28a1 UTSW 6 8168102 splice site probably null
R6054:Col28a1 UTSW 6 8083748 missense possibly damaging 0.96
R6159:Col28a1 UTSW 6 8162247 intron probably null
R6306:Col28a1 UTSW 6 8014969 missense probably damaging 0.96
R6379:Col28a1 UTSW 6 8012996 missense probably benign 0.00
R6665:Col28a1 UTSW 6 8062277 missense probably benign 0.08
R6809:Col28a1 UTSW 6 7999468 missense probably damaging 0.99
R7023:Col28a1 UTSW 6 8083763 missense possibly damaging 0.92
R7101:Col28a1 UTSW 6 8014795 missense possibly damaging 0.95
R7117:Col28a1 UTSW 6 8013122 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAGCTGTGTAGGCACTTAATC -3'
(R):5'- TTGGTCTGTCGCGTTCACAC -3'

Sequencing Primer
(F):5'- CAGACTGTATCCCTAGAAGGTGGTC -3'
(R):5'- CTCCCCTGATATCTTCAATGAGAG -3'
Posted On2019-09-13