Incidental Mutation 'R7376:Cntnap5b'
ID572361
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R7376 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99967269 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 89 (T89A)
Ref Sequence ENSEMBL: ENSMUSP00000083944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738]
Predicted Effect possibly damaging
Transcript: ENSMUST00000086738
AA Change: T89A

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: T89A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,291,118 I994V probably benign Het
Acan T G 7: 79,088,307 probably null Het
Adamts12 G A 15: 11,277,339 V680I possibly damaging Het
Adgrg7 T C 16: 56,724,979 I712V probably damaging Het
Adgrl3 A G 5: 81,794,750 H1477R probably damaging Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Alms1 T C 6: 85,622,106 S1305P probably benign Het
Banp T A 8: 121,974,497 M39K probably damaging Het
Bbs10 A G 10: 111,299,250 T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 CTGGTTCTG CTGGTTCTGCGGTCATTGGTTCTG 3: 95,888,155 probably benign Het
BC028528 GGTCACTGGTTCTGT GGTCACTGGTTCTGTTGTCACTGGTTCTGT 3: 95,888,165 probably benign Het
Brinp2 C T 1: 158,251,368 C295Y probably damaging Het
Card11 C T 5: 140,898,238 V429I probably benign Het
Cdca3 G A 6: 124,832,575 R184H probably benign Het
Clspn A G 4: 126,590,637 K1196R possibly damaging Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crat T A 2: 30,406,465 I330F probably damaging Het
Ctbp2 G T 7: 133,013,968 Q413K possibly damaging Het
D630045J12Rik T C 6: 38,174,303 E1220G probably damaging Het
Dap A G 15: 31,235,839 D41G probably damaging Het
Dnah14 A G 1: 181,763,402 I3287V probably benign Het
Dsp A G 13: 38,172,843 H233R probably damaging Het
Dst T C 1: 34,192,689 I3121T probably benign Het
Espnl T G 1: 91,322,314 L61R probably damaging Het
Evc2 T C 5: 37,370,639 S331P possibly damaging Het
Gars A G 6: 55,073,359 E535G probably benign Het
Hfm1 A G 5: 106,895,218 I650T possibly damaging Het
Iyd T A 10: 3,545,690 I116N probably damaging Het
Kif16b A G 2: 142,711,872 L1002S probably damaging Het
Kif1bp C T 10: 62,559,064 V600I possibly damaging Het
Lgi1 G A 19: 38,284,020 G113D probably damaging Het
Lgi2 G A 5: 52,538,262 R452C probably damaging Het
Man2b2 T G 5: 36,813,378 N764T probably damaging Het
Mrps18b A G 17: 35,910,695 I246T probably benign Het
Muc5b A G 7: 141,872,550 T4795A possibly damaging Het
Mybl2 G A 2: 163,082,593 G627D possibly damaging Het
Ndufb8 C T 19: 44,555,355 R16K probably benign Het
Olfr181 A T 16: 58,925,758 V271E possibly damaging Het
P4htm C T 9: 108,580,792 V335M probably damaging Het
Pbx3 A G 2: 34,204,877 I249T probably damaging Het
Plod3 G T 5: 136,990,481 V360L probably benign Het
Podxl2 C T 6: 88,849,650 D161N probably benign Het
Polr1b G T 2: 129,119,073 V651L probably benign Het
Prr14 T C 7: 127,476,577 S586P probably benign Het
Pum3 C T 19: 27,394,328 G575D probably benign Het
Rnf157 C A 11: 116,360,366 A111S probably benign Het
Robo3 A G 9: 37,432,916 L29P probably damaging Het
Smarca5 T C 8: 80,726,051 N342S probably damaging Het
Specc1 T A 11: 62,118,252 I198K probably benign Het
Tmem177 A T 1: 119,910,014 *312R probably null Het
Tom1l2 A T 11: 60,261,200 M172K probably benign Het
Tsc22d4 T C 5: 137,758,152 V3A unknown Het
Uhrf1bp1l G A 10: 89,809,656 G1197D probably damaging Het
Vmn1r128 G T 7: 21,349,743 G124V probably damaging Het
Vmn1r15 T C 6: 57,258,357 I70T probably benign Het
Vmn2r60 A G 7: 42,195,207 T665A probably damaging Het
Vmn2r83 T C 10: 79,478,956 F346S probably benign Het
Wdr7 T A 18: 63,777,620 D694E probably damaging Het
Xdh G A 17: 73,895,762 S1131F probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2069:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGTGCCCTGGGATATAAGTTAG -3'
(R):5'- ACTCTCACTGGTTAGCATTAGC -3'

Sequencing Primer
(F):5'- AAATTGGTTCTGAAACTAGGAGC -3'
(R):5'- CTCACTGGTTAGCATTAGCATATC -3'
Posted On2019-09-13