Incidental Mutation 'R7376:Brinp2'
ID572363
Institutional Source Beutler Lab
Gene Symbol Brinp2
Ensembl Gene ENSMUSG00000004031
Gene Namebone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms6430517E21Rik, Fam5b
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.195) question?
Stock #R7376 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location158245269-158356326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 158251368 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 295 (C295Y)
Ref Sequence ENSEMBL: ENSMUSP00000004133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004133] [ENSMUST00000195271]
Predicted Effect probably damaging
Transcript: ENSMUST00000004133
AA Change: C295Y

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000004133
Gene: ENSMUSG00000004031
AA Change: C295Y

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
MACPF 89 281 6.58e-50 SMART
Blast:MACPF 338 362 1e-5 BLAST
EGF 457 492 6.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195271
SMART Domains Protein: ENSMUSP00000141709
Gene: ENSMUSG00000004031

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:MACPF 63 160 2.1e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,291,118 I994V probably benign Het
Acan T G 7: 79,088,307 probably null Het
Adamts12 G A 15: 11,277,339 V680I possibly damaging Het
Adgrg7 T C 16: 56,724,979 I712V probably damaging Het
Adgrl3 A G 5: 81,794,750 H1477R probably damaging Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Alms1 T C 6: 85,622,106 S1305P probably benign Het
Banp T A 8: 121,974,497 M39K probably damaging Het
Bbs10 A G 10: 111,299,250 T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 CTGGTTCTG CTGGTTCTGCGGTCATTGGTTCTG 3: 95,888,155 probably benign Het
BC028528 GGTCACTGGTTCTGT GGTCACTGGTTCTGTTGTCACTGGTTCTGT 3: 95,888,165 probably benign Het
Card11 C T 5: 140,898,238 V429I probably benign Het
Cdca3 G A 6: 124,832,575 R184H probably benign Het
Clspn A G 4: 126,590,637 K1196R possibly damaging Het
Cntnap5b A G 1: 99,967,269 T89A possibly damaging Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crat T A 2: 30,406,465 I330F probably damaging Het
Ctbp2 G T 7: 133,013,968 Q413K possibly damaging Het
D630045J12Rik T C 6: 38,174,303 E1220G probably damaging Het
Dap A G 15: 31,235,839 D41G probably damaging Het
Dnah14 A G 1: 181,763,402 I3287V probably benign Het
Dsp A G 13: 38,172,843 H233R probably damaging Het
Dst T C 1: 34,192,689 I3121T probably benign Het
Espnl T G 1: 91,322,314 L61R probably damaging Het
Evc2 T C 5: 37,370,639 S331P possibly damaging Het
Gars A G 6: 55,073,359 E535G probably benign Het
Hfm1 A G 5: 106,895,218 I650T possibly damaging Het
Iyd T A 10: 3,545,690 I116N probably damaging Het
Kif16b A G 2: 142,711,872 L1002S probably damaging Het
Kif1bp C T 10: 62,559,064 V600I possibly damaging Het
Lgi1 G A 19: 38,284,020 G113D probably damaging Het
Lgi2 G A 5: 52,538,262 R452C probably damaging Het
Man2b2 T G 5: 36,813,378 N764T probably damaging Het
Mrps18b A G 17: 35,910,695 I246T probably benign Het
Muc5b A G 7: 141,872,550 T4795A possibly damaging Het
Mybl2 G A 2: 163,082,593 G627D possibly damaging Het
Ndufb8 C T 19: 44,555,355 R16K probably benign Het
Olfr181 A T 16: 58,925,758 V271E possibly damaging Het
P4htm C T 9: 108,580,792 V335M probably damaging Het
Pbx3 A G 2: 34,204,877 I249T probably damaging Het
Plod3 G T 5: 136,990,481 V360L probably benign Het
Podxl2 C T 6: 88,849,650 D161N probably benign Het
Polr1b G T 2: 129,119,073 V651L probably benign Het
Prr14 T C 7: 127,476,577 S586P probably benign Het
Pum3 C T 19: 27,394,328 G575D probably benign Het
Rnf157 C A 11: 116,360,366 A111S probably benign Het
Robo3 A G 9: 37,432,916 L29P probably damaging Het
Smarca5 T C 8: 80,726,051 N342S probably damaging Het
Specc1 T A 11: 62,118,252 I198K probably benign Het
Tmem177 A T 1: 119,910,014 *312R probably null Het
Tom1l2 A T 11: 60,261,200 M172K probably benign Het
Tsc22d4 T C 5: 137,758,152 V3A unknown Het
Uhrf1bp1l G A 10: 89,809,656 G1197D probably damaging Het
Vmn1r128 G T 7: 21,349,743 G124V probably damaging Het
Vmn1r15 T C 6: 57,258,357 I70T probably benign Het
Vmn2r60 A G 7: 42,195,207 T665A probably damaging Het
Vmn2r83 T C 10: 79,478,956 F346S probably benign Het
Wdr7 T A 18: 63,777,620 D694E probably damaging Het
Xdh G A 17: 73,895,762 S1131F probably damaging Het
Other mutations in Brinp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Brinp2 APN 1 158247100 missense probably benign 0.04
IGL01537:Brinp2 APN 1 158246809 missense probably damaging 1.00
IGL02354:Brinp2 APN 1 158247178 missense probably damaging 1.00
IGL02361:Brinp2 APN 1 158247178 missense probably damaging 1.00
R0334:Brinp2 UTSW 1 158295585 missense probably benign 0.06
R0652:Brinp2 UTSW 1 158246621 missense probably damaging 1.00
R1017:Brinp2 UTSW 1 158249451 missense probably damaging 0.99
R1141:Brinp2 UTSW 1 158247270 missense probably damaging 0.99
R1378:Brinp2 UTSW 1 158247054 missense possibly damaging 0.82
R1666:Brinp2 UTSW 1 158246558 missense probably damaging 1.00
R1892:Brinp2 UTSW 1 158254972 critical splice donor site probably null
R1986:Brinp2 UTSW 1 158246778 missense probably damaging 1.00
R3876:Brinp2 UTSW 1 158246846 missense probably damaging 0.99
R3924:Brinp2 UTSW 1 158246208 missense probably damaging 1.00
R4582:Brinp2 UTSW 1 158267938 missense probably damaging 1.00
R5239:Brinp2 UTSW 1 158251338 missense probably benign 0.00
R5537:Brinp2 UTSW 1 158255013 missense probably damaging 0.97
R5582:Brinp2 UTSW 1 158249409 missense probably damaging 1.00
R5762:Brinp2 UTSW 1 158246586 missense probably benign
R5922:Brinp2 UTSW 1 158249355 missense possibly damaging 0.79
R6746:Brinp2 UTSW 1 158266590 missense probably benign
R6999:Brinp2 UTSW 1 158251305 missense probably benign 0.20
R7144:Brinp2 UTSW 1 158295424 critical splice donor site probably null
R7221:Brinp2 UTSW 1 158266547 missense possibly damaging 0.90
R7381:Brinp2 UTSW 1 158246343 missense probably benign 0.11
R7388:Brinp2 UTSW 1 158255009 missense probably damaging 1.00
R7531:Brinp2 UTSW 1 158266572 missense possibly damaging 0.95
X0024:Brinp2 UTSW 1 158267983 nonsense probably null
Z1088:Brinp2 UTSW 1 158246989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCATCTACTCTTTGTTATGGG -3'
(R):5'- CCGTTTGGATTCCTACAGCC -3'

Sequencing Primer
(F):5'- GGAAAATTCCCAGCTAGTAGCCTG -3'
(R):5'- CTGCAGCACTCAGCTAC -3'
Posted On2019-09-13