Incidental Mutation 'R7378:Htt'
ID572454
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Namehuntingtin
SynonymsHD, Hdh, htt, huntingtin, IT15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7378 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34761740-34912534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34803799 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 257 (I257F)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
Predicted Effect probably benign
Transcript: ENSMUST00000080036
AA Change: I257F

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: I257F

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 135 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A C 6: 128,546,247 probably null Het
Aars A G 8: 111,042,342 Y258C probably damaging Het
Acaa2 A T 18: 74,805,872 Y376F probably benign Het
Adcy1 C T 11: 7,169,543 S1062F possibly damaging Het
Adgrb3 A T 1: 25,531,919 C492* probably null Het
Adgrg6 A G 10: 14,535,892 F22S probably benign Het
Afm T A 5: 90,551,400 C568S probably benign Het
Ago4 C T 4: 126,511,464 E439K probably benign Het
Aifm2 T G 10: 61,727,717 V122G possibly damaging Het
Akap6 A G 12: 53,142,574 N2257S probably benign Het
Ap3m2 A G 8: 22,804,010 I8T probably benign Het
Apc2 C A 10: 80,311,394 L761I probably damaging Het
Arntl C A 7: 113,299,208 T281K probably benign Het
Asna1 A T 8: 85,019,863 F119I probably benign Het
Asxl1 T C 2: 153,401,993 C1489R probably damaging Het
Atm T G 9: 53,453,437 probably null Het
Bpifa6 C A 2: 153,986,433 A153E probably damaging Het
Cav2 A G 6: 17,282,060 T106A probably benign Het
Cavin4 A G 4: 48,663,631 N4D probably benign Het
Cenpc1 T C 5: 86,046,499 N136S probably benign Het
Crocc2 C T 1: 93,194,087 L653F probably damaging Het
Cry2 A G 2: 92,413,664 L388P probably damaging Het
Cstb T C 10: 78,426,988 F43S probably damaging Het
Ctcfl A G 2: 173,112,258 Y349H probably damaging Het
Ctu2 T A 8: 122,481,499 V485D probably damaging Het
Cwc25 A C 11: 97,747,997 L367R possibly damaging Het
Dock4 T A 12: 40,788,244 H1061Q possibly damaging Het
Dpy19l3 C A 7: 35,752,642 V26L probably benign Het
Dusp27 G T 1: 166,112,063 S58* probably null Het
Elmo1 A T 13: 20,280,935 I225F probably benign Het
Ep300 T C 15: 81,650,545 S2268P probably damaging Het
F2r C T 13: 95,618,328 C16Y probably damaging Het
Fam126b T C 1: 58,530,034 K462R probably benign Het
Fbxo33 C A 12: 59,204,371 E453* probably null Het
Flot1 A T 17: 35,825,513 D186V probably damaging Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Fras1 T C 5: 96,596,785 C560R probably damaging Het
Gfi1 A T 5: 107,723,229 S165T possibly damaging Het
Gli2 T C 1: 118,848,492 D400G probably damaging Het
Gm11639 T C 11: 104,714,702 I298T probably benign Het
Gml C T 15: 74,817,121 V27I possibly damaging Het
Ier5 C T 1: 155,098,692 V247M probably damaging Het
Ift46 C T 9: 44,778,595 probably benign Het
Il12b A G 11: 44,407,894 T59A probably benign Het
Insr A G 8: 3,198,231 L438P probably damaging Het
Iqgap2 C T 13: 95,732,890 probably null Het
Irx4 A T 13: 73,267,553 T154S possibly damaging Het
Itgbl1 A G 14: 123,857,489 K309E probably benign Het
Kcns2 T A 15: 34,839,703 L404* probably null Het
Kif2c T C 4: 117,162,029 E644G possibly damaging Het
Klhl22 T C 16: 17,776,805 L266P probably damaging Het
Krt71 T A 15: 101,738,329 K315* probably null Het
Lca5 T C 9: 83,395,530 N587S probably benign Het
Lrp1b T A 2: 41,295,669 M1459L Het
Lrrtm2 T C 18: 35,213,592 K219R probably damaging Het
Mcmbp T C 7: 128,704,517 D459G probably damaging Het
Megf8 A G 7: 25,348,942 H1680R probably damaging Het
Mia3 A G 1: 183,334,775 S301P probably benign Het
Mtrr A G 13: 68,564,402 Y622H probably damaging Het
Myo7b T A 18: 31,966,239 Q1710L probably damaging Het
Nab1 T C 1: 52,480,995 N276D probably damaging Het
Nalcn C T 14: 123,302,890 R1127H probably damaging Het
Nbas T A 12: 13,274,219 I110N probably damaging Het
Nfe2l3 C T 6: 51,457,296 Q279* probably null Het
Nlrp9c C T 7: 26,365,015 E963K probably benign Het
Nsmaf A G 4: 6,416,586 V569A probably benign Het
Olfr1066 T C 2: 86,456,068 T68A probably benign Het
Olfr1338 T C 4: 118,754,175 Y123C possibly damaging Het
Olfr199 T A 16: 59,215,920 D231V probably benign Het
Olfr273 C T 4: 52,856,421 V31I probably benign Het
Olfr481 T C 7: 108,081,192 S133P not run Het
Olfr669 A T 7: 104,939,431 I302F probably benign Het
Olfr69 T A 7: 103,767,930 I156F probably benign Het
Olfr851 T A 9: 19,497,102 M118K probably damaging Het
Olfr857 A T 9: 19,712,887 D20V probably damaging Het
Olfr933 T A 9: 38,975,721 V15E probably benign Het
Paf1 A G 7: 28,396,928 Y322C probably damaging Het
Pcdha2 C A 18: 36,939,385 A23D possibly damaging Het
Pcdhb6 G A 18: 37,335,172 C382Y probably damaging Het
Pdzd7 C T 19: 45,045,606 G13D probably damaging Het
Pik3r2 T C 8: 70,769,381 N586S probably benign Het
Pik3r3 T A 4: 116,270,830 D119E probably benign Het
Pkd2l1 T A 19: 44,153,715 I535F probably benign Het
Ppl T A 16: 5,112,996 Q53L possibly damaging Het
Rimbp3 T G 16: 17,211,204 S831A probably benign Het
Rnps1 A G 17: 24,418,530 T49A unknown Het
Rrm2b T A 15: 37,931,647 E248D probably benign Het
Sdhaf4 A G 1: 23,996,358 F70L probably damaging Het
Sel1l3 A T 5: 53,116,409 S1038R probably benign Het
Selenoo T A 15: 89,089,478 F124I probably benign Het
Setbp1 A T 18: 78,857,486 Y989N probably damaging Het
Slc1a7 A G 4: 108,002,203 E163G possibly damaging Het
Slc22a2 T C 17: 12,612,391 F356S probably damaging Het
Slc24a4 C T 12: 102,239,176 P378L probably benign Het
Slc4a1ap A G 5: 31,527,527 D169G probably benign Het
Slc4a7 T A 14: 14,757,421 V422D probably damaging Het
Slitrk6 T C 14: 110,749,863 Y804C probably damaging Het
Smarcad1 T A 6: 65,110,376 H906Q probably benign Het
Smn1 A G 13: 100,127,865 T109A probably damaging Het
Sntb2 A G 8: 106,981,312 N236S probably damaging Het
Spag9 T A 11: 94,114,351 probably null Het
Spg11 C A 2: 122,058,429 G2154W probably damaging Het
Srsf6 T C 2: 162,934,569 S278P unknown Het
Stag3 G A 5: 138,281,960 R29H probably benign Het
Stambp C T 6: 83,563,906 V98I not run Het
Suco T C 1: 161,862,211 D89G possibly damaging Het
Suox C T 10: 128,671,041 V373I probably benign Het
Sv2b T A 7: 75,147,728 probably null Het
Tatdn2 T C 6: 113,704,701 L565P probably damaging Het
Tbpl2 T A 2: 24,094,700 E145V probably benign Het
Tlr1 T C 5: 64,925,228 I669V not run Het
Tmc1 A T 19: 20,868,389 F157I probably damaging Het
Tmem26 T G 10: 68,724,092 probably null Het
Tmem33 A T 5: 67,286,133 I218F probably benign Het
Tmem94 T A 11: 115,794,174 D862E probably damaging Het
Tnr T C 1: 159,884,862 probably null Het
Tnrc6c T C 11: 117,741,780 S1103P probably benign Het
Tomm70a T A 16: 57,146,044 Y453* probably null Het
Trabd C A 15: 89,085,290 R229S possibly damaging Het
Trappc10 T C 10: 78,193,418 D1095G probably damaging Het
Trim27 A G 13: 21,192,461 T460A possibly damaging Het
Tsen54 T G 11: 115,821,705 D433E probably benign Het
Ubap2 A G 4: 41,235,515 probably null Het
Vat1l A T 8: 114,289,392 N341Y possibly damaging Het
Vmn2r82 C G 10: 79,396,442 Y758* probably null Het
Vps16 T G 2: 130,438,179 V108G probably damaging Het
Vps53 T A 11: 76,077,074 I585F possibly damaging Het
Wrnip1 G A 13: 32,816,281 V424M probably benign Het
Yif1a G A 19: 5,089,790 V88M possibly damaging Het
Zfat T C 15: 68,181,120 Y275C probably damaging Het
Zfhx3 A G 8: 108,793,248 E334G probably damaging Het
Zfp277 T C 12: 40,315,853 D539G possibly damaging Het
Zfp292 A T 4: 34,808,384 N1558K probably benign Het
Zfp3 A G 11: 70,772,073 K286R probably benign Het
Zfp366 T C 13: 99,229,515 C395R probably damaging Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34799408 missense probably benign 0.00
IGL00233:Htt APN 5 34896026 splice site probably null
IGL00559:Htt APN 5 34849104 splice site probably benign
IGL00765:Htt APN 5 34877425 splice site probably benign
IGL00950:Htt APN 5 34891441 missense probably benign
IGL00953:Htt APN 5 34818677 missense probably benign 0.04
IGL00957:Htt APN 5 34806724 missense probably benign
IGL01314:Htt APN 5 34878856 missense probably benign
IGL01412:Htt APN 5 34898572 missense probably damaging 0.98
IGL01510:Htt APN 5 34907512 missense probably damaging 1.00
IGL01617:Htt APN 5 34876755 missense possibly damaging 0.67
IGL01893:Htt APN 5 34876830 missense probably damaging 1.00
IGL01914:Htt APN 5 34829709 missense probably benign
IGL01994:Htt APN 5 34832604 missense possibly damaging 0.83
IGL02102:Htt APN 5 34891481 splice site probably benign
IGL02381:Htt APN 5 34829760 missense probably benign 0.03
IGL02529:Htt APN 5 34819043 splice site probably benign
IGL02678:Htt APN 5 34899902 missense probably damaging 1.00
IGL02707:Htt APN 5 34829881 critical splice donor site probably null
IGL02731:Htt APN 5 34803793 missense probably benign 0.41
IGL02931:Htt APN 5 34876753 missense probably damaging 1.00
IGL03167:Htt APN 5 34818986 missense probably damaging 0.98
IGL03343:Htt APN 5 34826041 missense probably benign
IGL03344:Htt APN 5 34907466 missense probably benign 0.02
IGL03344:Htt APN 5 34879828 missense probably benign 0.39
IGL03366:Htt APN 5 34907580 missense probably damaging 1.00
IGL03410:Htt APN 5 34799445 missense probably damaging 0.99
Chalk UTSW 5 34907086 missense possibly damaging 0.86
IGL02796:Htt UTSW 5 34877482 missense probably benign 0.43
PIT4377001:Htt UTSW 5 34875965 missense probably benign 0.10
R0013:Htt UTSW 5 34820104 missense probably benign 0.25
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0056:Htt UTSW 5 34826078 splice site probably benign
R0207:Htt UTSW 5 34896908 missense probably benign 0.11
R0329:Htt UTSW 5 34817134 splice site probably benign
R0494:Htt UTSW 5 34821844 missense possibly damaging 0.73
R0548:Htt UTSW 5 34870746 missense probably damaging 1.00
R0601:Htt UTSW 5 34846003 missense probably benign 0.08
R0799:Htt UTSW 5 34817753 missense probably benign 0.00
R0947:Htt UTSW 5 34898924 missense probably damaging 1.00
R1053:Htt UTSW 5 34851217 critical splice acceptor site probably null
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1478:Htt UTSW 5 34803827 missense probably damaging 0.99
R1573:Htt UTSW 5 34864374 splice site probably benign
R1677:Htt UTSW 5 34828574 missense probably damaging 1.00
R1792:Htt UTSW 5 34907199 missense probably damaging 1.00
R1816:Htt UTSW 5 34803740 missense probably benign 0.01
R1833:Htt UTSW 5 34905748 splice site probably benign
R1837:Htt UTSW 5 34819023 missense probably benign 0.00
R1846:Htt UTSW 5 34848944 missense probably damaging 0.98
R1875:Htt UTSW 5 34794112 missense probably benign 0.05
R1899:Htt UTSW 5 34907085 missense probably benign 0.01
R2013:Htt UTSW 5 34852871 missense probably damaging 0.99
R2062:Htt UTSW 5 34825982 missense probably benign 0.00
R2064:Htt UTSW 5 34825982 missense probably benign 0.00
R2067:Htt UTSW 5 34825982 missense probably benign 0.00
R2068:Htt UTSW 5 34825982 missense probably benign 0.00
R2131:Htt UTSW 5 34877109 missense possibly damaging 0.50
R2162:Htt UTSW 5 34821718 missense probably benign 0.44
R2169:Htt UTSW 5 34877475 missense probably benign 0.08
R2345:Htt UTSW 5 34826004 missense possibly damaging 0.80
R2433:Htt UTSW 5 34907541 missense possibly damaging 0.65
R3027:Htt UTSW 5 34820095 missense possibly damaging 0.85
R3123:Htt UTSW 5 34804531 missense probably benign
R3125:Htt UTSW 5 34804531 missense probably benign
R3717:Htt UTSW 5 34811522 splice site probably benign
R3758:Htt UTSW 5 34895970 missense probably damaging 0.97
R3805:Htt UTSW 5 34877204 splice site probably null
R3833:Htt UTSW 5 34821718 missense probably benign 0.44
R4066:Htt UTSW 5 34878847 missense probably benign
R4272:Htt UTSW 5 34849069 missense possibly damaging 0.96
R4625:Htt UTSW 5 34829785 missense probably damaging 0.99
R4634:Htt UTSW 5 34875948 missense probably benign 0.06
R4655:Htt UTSW 5 34906132 missense probably benign 0.06
R4679:Htt UTSW 5 34820080 missense probably benign
R4684:Htt UTSW 5 34852765 missense probably damaging 1.00
R4832:Htt UTSW 5 34824840 missense probably benign 0.01
R4833:Htt UTSW 5 34852225 missense probably damaging 0.98
R4973:Htt UTSW 5 34813023 missense probably damaging 0.99
R5095:Htt UTSW 5 34824395 missense possibly damaging 0.89
R5132:Htt UTSW 5 34905679 missense possibly damaging 0.89
R5351:Htt UTSW 5 34803833 missense probably damaging 0.99
R5361:Htt UTSW 5 34907584 missense possibly damaging 0.47
R5399:Htt UTSW 5 34877151 missense probably damaging 0.98
R5462:Htt UTSW 5 34885507 nonsense probably null
R5552:Htt UTSW 5 34821774 missense probably benign
R5566:Htt UTSW 5 34849075 missense probably damaging 1.00
R5595:Htt UTSW 5 34905397 missense probably damaging 0.96
R5617:Htt UTSW 5 34870806 missense possibly damaging 0.77
R5835:Htt UTSW 5 34813190 missense probably benign 0.16
R5891:Htt UTSW 5 34870823 missense possibly damaging 0.62
R6158:Htt UTSW 5 34907086 missense possibly damaging 0.86
R6159:Htt UTSW 5 34804676 missense probably benign 0.08
R6169:Htt UTSW 5 34907473 missense probably damaging 1.00
R6242:Htt UTSW 5 34846012 missense probably damaging 1.00
R6274:Htt UTSW 5 34852087 missense possibly damaging 0.81
R6280:Htt UTSW 5 34870759 missense probably benign 0.00
R6294:Htt UTSW 5 34821826 missense probably benign
R6331:Htt UTSW 5 34895887 missense possibly damaging 0.89
R6448:Htt UTSW 5 34875992 missense probably benign 0.05
R6474:Htt UTSW 5 34824895 missense probably benign 0.06
R6592:Htt UTSW 5 34877044 missense possibly damaging 0.92
R6818:Htt UTSW 5 34782767 missense probably damaging 0.99
R6830:Htt UTSW 5 34834326 missense possibly damaging 0.82
R6920:Htt UTSW 5 34877100 missense probably null 1.00
R6962:Htt UTSW 5 34899771 critical splice acceptor site probably null
R7057:Htt UTSW 5 34821723 missense probably null 0.05
R7144:Htt UTSW 5 34846006 missense probably damaging 1.00
R7166:Htt UTSW 5 34852894 missense probably benign 0.42
R7329:Htt UTSW 5 34829755 missense probably benign 0.03
R7418:Htt UTSW 5 34790353 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CAGCCTTCCTAATGCGATTAATAAG -3'
(R):5'- ACACTTCACATTTAGCAGTCAGC -3'

Sequencing Primer
(F):5'- GCTCCATCTATGAAAAATGTGTCATC -3'
(R):5'- GTCAGCAGCTGCAAATGGTCTAATC -3'
Posted On2019-09-13