Incidental Mutation 'R7379:Sorcs3'
ID572600
Institutional Source Beutler Lab
Gene Symbol Sorcs3
Ensembl Gene ENSMUSG00000063434
Gene Namesortilin-related VPS10 domain containing receptor 3
Synonyms6330404A12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7379 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location48206025-48805505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48772266 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 911 (V911A)
Ref Sequence ENSEMBL: ENSMUSP00000077919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078880]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078880
AA Change: V911A

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: V911A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 69 91 N/A INTRINSIC
VPS10 216 818 N/A SMART
Pfam:PKD 823 901 8e-13 PFAM
transmembrane domain 1122 1141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Ift57 A G 16: 49,760,994 E341G probably damaging Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Other mutations in Sorcs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sorcs3 APN 19 48683658 critical splice donor site probably null
IGL00233:Sorcs3 APN 19 48748319 missense probably benign 0.12
IGL00482:Sorcs3 APN 19 48603864 missense probably benign 0.00
IGL00976:Sorcs3 APN 19 48767103 missense probably damaging 1.00
IGL01367:Sorcs3 APN 19 48796375 missense probably damaging 1.00
IGL01390:Sorcs3 APN 19 48790131 missense probably damaging 1.00
IGL01548:Sorcs3 APN 19 48794168 missense possibly damaging 0.87
IGL02162:Sorcs3 APN 19 48535531 missense probably damaging 0.98
IGL02165:Sorcs3 APN 19 48654072 missense probably benign 0.03
IGL02404:Sorcs3 APN 19 48704370 splice site probably benign
IGL02830:Sorcs3 APN 19 48723002 splice site probably null
IGL02943:Sorcs3 APN 19 48759938 missense probably benign 0.00
R0371:Sorcs3 UTSW 19 48603894 missense probably benign 0.00
R0456:Sorcs3 UTSW 19 48654044 missense possibly damaging 0.94
R0466:Sorcs3 UTSW 19 48748319 missense probably benign 0.12
R0470:Sorcs3 UTSW 19 48797517 critical splice donor site probably null
R0536:Sorcs3 UTSW 19 48802698 nonsense probably null
R0646:Sorcs3 UTSW 19 48206295 missense probably benign 0.10
R0709:Sorcs3 UTSW 19 48487406 missense probably benign
R0792:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R0831:Sorcs3 UTSW 19 48693994 missense probably damaging 1.00
R0836:Sorcs3 UTSW 19 48487394 missense probably benign
R1253:Sorcs3 UTSW 19 48206736 missense possibly damaging 0.67
R1390:Sorcs3 UTSW 19 48694001 critical splice donor site probably null
R1522:Sorcs3 UTSW 19 48706009 missense possibly damaging 0.84
R1570:Sorcs3 UTSW 19 48764181 missense probably damaging 1.00
R1637:Sorcs3 UTSW 19 48748359 critical splice donor site probably null
R1766:Sorcs3 UTSW 19 48603875 missense possibly damaging 0.87
R1894:Sorcs3 UTSW 19 48794274 missense probably benign 0.23
R2426:Sorcs3 UTSW 19 48722925 missense probably damaging 1.00
R3789:Sorcs3 UTSW 19 48398711 missense possibly damaging 0.46
R3818:Sorcs3 UTSW 19 48603904 missense probably benign 0.00
R3824:Sorcs3 UTSW 19 48722956 missense probably damaging 1.00
R3934:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R3936:Sorcs3 UTSW 19 48713504 missense probably damaging 1.00
R4190:Sorcs3 UTSW 19 48749373 missense possibly damaging 0.69
R4604:Sorcs3 UTSW 19 48693914 missense probably benign 0.35
R4644:Sorcs3 UTSW 19 48683597 missense probably damaging 1.00
R4774:Sorcs3 UTSW 19 48794163 missense probably benign 0.23
R4801:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4802:Sorcs3 UTSW 19 48398744 missense possibly damaging 0.46
R4945:Sorcs3 UTSW 19 48764148 missense possibly damaging 0.50
R5049:Sorcs3 UTSW 19 48759951 missense possibly damaging 0.93
R5175:Sorcs3 UTSW 19 48759845 critical splice acceptor site probably null
R5342:Sorcs3 UTSW 19 48796472 splice site probably null
R5848:Sorcs3 UTSW 19 48788511 missense probably damaging 1.00
R5959:Sorcs3 UTSW 19 48749396 missense probably damaging 1.00
R5977:Sorcs3 UTSW 19 48796450 missense probably damaging 1.00
R6155:Sorcs3 UTSW 19 48398697 missense possibly damaging 0.94
R6222:Sorcs3 UTSW 19 48759857 missense possibly damaging 0.57
R6268:Sorcs3 UTSW 19 48790166 missense probably damaging 1.00
R6416:Sorcs3 UTSW 19 48802759 missense probably damaging 1.00
R6425:Sorcs3 UTSW 19 48764307 critical splice donor site probably null
R6623:Sorcs3 UTSW 19 48788505 missense probably benign 0.00
R6767:Sorcs3 UTSW 19 48713571 missense probably damaging 0.99
R6888:Sorcs3 UTSW 19 48693824 missense possibly damaging 0.83
R6955:Sorcs3 UTSW 19 48749343 missense possibly damaging 0.82
R7106:Sorcs3 UTSW 19 48705963 missense probably damaging 1.00
X0018:Sorcs3 UTSW 19 48772289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCCCAGCATTTTAGCAC -3'
(R):5'- ATACTAGAATTGCATGCCCAGTTC -3'

Sequencing Primer
(F):5'- GCCCAGCATTTTAGCACTTGTG -3'
(R):5'- CGCCAGAGCATAGGAATCTAGATC -3'
Posted On2019-09-13