Incidental Mutation 'R7380:Ptch2'
ID572619
Institutional Source Beutler Lab
Gene Symbol Ptch2
Ensembl Gene ENSMUSG00000028681
Gene Namepatched 2
Synonymsptc2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7380 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location117096075-117116101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 117114646 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1122 (Q1122K)
Ref Sequence ENSEMBL: ENSMUSP00000030443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030443] [ENSMUST00000144620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030443
AA Change: Q1122K

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030443
Gene: ENSMUSG00000028681
AA Change: Q1122K

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Pfam:Patched 338 831 1.6e-42 PFAM
Pfam:Sterol-sensing 418 570 9.5e-49 PFAM
Pfam:Patched 901 1116 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144620
SMART Domains Protein: ENSMUSP00000122548
Gene: ENSMUSG00000028681

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the patched family of transmembrane receptor proteins. The encoded protein may be a functional receptor for the morphogen sonic hedgehog (Shh) and is reportedly involved in limb and skin development. Homozygous mutant mice for this gene exhibit hair loss and epidermal hyperplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Male mice homozygous for a targeted gene disruption display anemia, abnormal red blood cells, enlarged spleens, extramedullary hematopoiesis, and an increased percentage of neutrophils. Most male mice homozygous for another allele display alopecia and skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,279,481 Q127* probably null Het
1700030J22Rik T C 8: 116,973,637 T9A probably benign Het
Abcc5 A T 16: 20,397,034 S414R possibly damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Ankib1 G T 5: 3,722,576 Q487K probably benign Het
BC034090 T G 1: 155,232,483 S11R probably damaging Het
Car12 A G 9: 66,747,663 N125S probably benign Het
Casq1 A G 1: 172,216,849 V137A probably benign Het
Ccdc144b T A 3: 36,025,921 D229V possibly damaging Het
Cd163l1 A T 7: 140,224,877 N598Y possibly damaging Het
Cfap54 C A 10: 93,047,978 V305F probably damaging Het
Clstn3 T C 6: 124,456,989 E404G probably benign Het
Copg1 T G 6: 87,893,842 L209R probably damaging Het
Cpb2 A T 14: 75,256,009 Q42L possibly damaging Het
Cpd G A 11: 76,802,325 Q712* probably null Het
Csmd3 T A 15: 47,586,965 Y2690F Het
Dchs1 G T 7: 105,758,628 T1999K probably benign Het
Ddx10 T A 9: 53,240,486 T80S probably damaging Het
Dmtn G A 14: 70,617,328 T69I probably damaging Het
Dnah5 T A 15: 28,370,378 H2821Q probably damaging Het
Fam162b T A 10: 51,590,476 probably benign Het
Fam193b A C 13: 55,542,799 S717A probably benign Het
Far2 T C 6: 148,180,995 F500L unknown Het
Focad T A 4: 88,274,198 V588D unknown Het
Gm12728 T C 4: 105,794,396 F68L probably damaging Het
Gm1527 T A 3: 28,920,472 M478K probably benign Het
Gpd2 A T 2: 57,340,159 I308F probably damaging Het
Igf2bp3 T C 6: 49,108,999 T249A probably benign Het
Igfn1 C A 1: 135,962,008 V2434F probably damaging Het
Kdm5a C A 6: 120,405,918 Q737K probably benign Het
Khdrbs2 T C 1: 32,333,604 S120P unknown Het
Lmx1a T C 1: 167,692,040 F46L probably damaging Het
Lrba C G 3: 86,325,074 T776R probably damaging Het
Lrrc8c A G 5: 105,607,835 N492S possibly damaging Het
Mapk3 A T 7: 126,764,795 I365F Het
Mcee A G 7: 64,411,909 I153M possibly damaging Het
Mllt3 T C 4: 87,791,943 D415G possibly damaging Het
Muc4 A T 16: 32,755,366 T1747S unknown Het
Myh14 A T 7: 44,661,042 V139E probably damaging Het
Myo10 A T 15: 25,779,620 I772L probably benign Het
Nbeal1 T A 1: 60,244,810 I841N probably damaging Het
Nf1 C T 11: 79,546,276 T2006I probably damaging Het
Npr2 T A 4: 43,641,254 W427R probably damaging Het
Nr1h3 A T 2: 91,190,195 F324L possibly damaging Het
Obscn T C 11: 59,056,914 K4430E Het
Olfr203 A G 16: 59,304,028 R292G probably damaging Het
Olfr213 T C 6: 116,540,933 L160P probably benign Het
Olfr791 A T 10: 129,526,661 T145S probably benign Het
Osgin1 T A 8: 119,445,431 H321Q probably benign Het
P4ha1 A G 10: 59,350,451 I251V probably benign Het
Padi2 G A 4: 140,917,686 W77* probably null Het
Pkd1 T A 17: 24,581,642 I3086N probably damaging Het
Plk3 T C 4: 117,131,153 N360S probably benign Het
Prr14 A T 7: 127,476,442 S541C probably null Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rad50 T C 11: 53,695,396 I258V probably benign Het
Rapgef3 G T 15: 97,766,791 R64S probably benign Het
Rbm44 A G 1: 91,152,216 N42S possibly damaging Het
Ring1 T C 17: 34,021,720 Y361C probably damaging Het
Robo3 T C 9: 37,418,556 T1155A probably damaging Het
Rsf1 GGCGG GGCGGTGGCCGCGG 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,640,157 T4682A probably damaging Het
Sema7a T C 9: 57,961,564 V653A unknown Het
Slc16a13 T C 11: 70,219,279 Y132C probably damaging Het
Slc24a1 A G 9: 64,948,533 V364A unknown Het
Slc8a2 C T 7: 16,134,353 A170V probably damaging Het
Slfn8 C T 11: 83,003,740 R691Q not run Het
Snx2 T C 18: 53,194,568 V122A probably benign Het
Sstr1 A T 12: 58,213,280 M230L probably benign Het
Themis2 C T 4: 132,786,217 V233I possibly damaging Het
Tmem106b T C 6: 13,078,168 S121P probably damaging Het
Tmem63c A G 12: 87,077,948 I529V probably benign Het
Tmem94 T C 11: 115,796,145 probably null Het
Trmt10c A T 16: 56,034,256 W339R probably damaging Het
Ugt2b1 A T 5: 86,917,719 F487Y not run Het
Vmn2r91 T A 17: 18,136,576 L835* probably null Het
Vps52 C A 17: 33,958,309 N108K possibly damaging Het
Wdpcp T A 11: 21,711,585 C286S possibly damaging Het
Zfp959 T A 17: 55,898,551 H529Q possibly damaging Het
Other mutations in Ptch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Ptch2 APN 4 117114082 missense probably damaging 1.00
IGL01684:Ptch2 APN 4 117104787 missense probably damaging 1.00
IGL01967:Ptch2 APN 4 117114233 splice site probably benign
IGL02449:Ptch2 APN 4 117108183 missense possibly damaging 0.79
IGL02488:Ptch2 APN 4 117110396 missense probably damaging 0.99
IGL02935:Ptch2 APN 4 117114770 missense probably damaging 1.00
R0103:Ptch2 UTSW 4 117109425 splice site probably benign
R0326:Ptch2 UTSW 4 117108884 missense probably damaging 1.00
R0403:Ptch2 UTSW 4 117110839 nonsense probably null
R0499:Ptch2 UTSW 4 117111143 nonsense probably null
R0550:Ptch2 UTSW 4 117096433 splice site probably benign
R0565:Ptch2 UTSW 4 117106143 splice site probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1484:Ptch2 UTSW 4 117110849 missense probably damaging 0.97
R1920:Ptch2 UTSW 4 117108661 missense probably benign 0.09
R4080:Ptch2 UTSW 4 117111206 missense probably damaging 1.00
R4611:Ptch2 UTSW 4 117110378 missense probably benign 0.24
R5117:Ptch2 UTSW 4 117105949 missense probably damaging 1.00
R5240:Ptch2 UTSW 4 117106138 splice site probably benign
R5936:Ptch2 UTSW 4 117108294 missense probably benign 0.39
R5987:Ptch2 UTSW 4 117110057 missense probably benign 0.13
R6155:Ptch2 UTSW 4 117096908 missense probably damaging 1.00
R7158:Ptch2 UTSW 4 117114784 missense possibly damaging 0.76
R7196:Ptch2 UTSW 4 117114749 missense probably benign 0.23
R7346:Ptch2 UTSW 4 117114652 missense probably benign 0.40
X0019:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0024:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0025:Ptch2 UTSW 4 117096986 missense probably damaging 1.00
X0035:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0038:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0039:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0040:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0052:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0053:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0054:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0061:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ATAACCAAAGGCCCTCAGTGG -3'
(R):5'- GACCCAGTCCTCTACAACTGAG -3'

Sequencing Primer
(F):5'- AAAGGCCCTCAGTGGCTAGC -3'
(R):5'- AGGAGACTATGTGGGCTCCTC -3'
Posted On2019-09-13