Incidental Mutation 'R7380:Kdm5a'
ID572631
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7380 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 120405918 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 737 (Q737K)
Ref Sequence ENSEMBL: ENSMUSP00000005108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108] [ENSMUST00000132009] [ENSMUST00000135802]
Predicted Effect probably benign
Transcript: ENSMUST00000005108
AA Change: Q737K

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: Q737K

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132009
SMART Domains Protein: ENSMUSP00000145375
Gene: ENSMUSG00000030180

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
JmjC 437 603 1.47e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135802
AA Change: Q737K

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000145021
Gene: ENSMUSG00000030180
AA Change: Q737K

DomainStartEndE-ValueType
JmjN 18 59 1.7e-22 SMART
ARID 81 170 3.6e-39 SMART
BRIGHT 85 175 1.2e-33 SMART
PHD 295 341 7.3e-17 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 2.2e-75 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 728 6.3e-15 PFAM
Pfam:PLU-1 741 811 9.8e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik G A 9: 103,279,481 Q127* probably null Het
1700030J22Rik T C 8: 116,973,637 T9A probably benign Het
Abcc5 A T 16: 20,397,034 S414R possibly damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Ankib1 G T 5: 3,722,576 Q487K probably benign Het
BC034090 T G 1: 155,232,483 S11R probably damaging Het
Car12 A G 9: 66,747,663 N125S probably benign Het
Casq1 A G 1: 172,216,849 V137A probably benign Het
Ccdc144b T A 3: 36,025,921 D229V possibly damaging Het
Cd163l1 A T 7: 140,224,877 N598Y possibly damaging Het
Cfap54 C A 10: 93,047,978 V305F probably damaging Het
Clstn3 T C 6: 124,456,989 E404G probably benign Het
Copg1 T G 6: 87,893,842 L209R probably damaging Het
Cpb2 A T 14: 75,256,009 Q42L possibly damaging Het
Cpd G A 11: 76,802,325 Q712* probably null Het
Csmd3 T A 15: 47,586,965 Y2690F Het
Dchs1 G T 7: 105,758,628 T1999K probably benign Het
Ddx10 T A 9: 53,240,486 T80S probably damaging Het
Dmtn G A 14: 70,617,328 T69I probably damaging Het
Dnah5 T A 15: 28,370,378 H2821Q probably damaging Het
Fam162b T A 10: 51,590,476 probably benign Het
Fam193b A C 13: 55,542,799 S717A probably benign Het
Far2 T C 6: 148,180,995 F500L unknown Het
Focad T A 4: 88,274,198 V588D unknown Het
Gm12728 T C 4: 105,794,396 F68L probably damaging Het
Gm1527 T A 3: 28,920,472 M478K probably benign Het
Gpd2 A T 2: 57,340,159 I308F probably damaging Het
Igf2bp3 T C 6: 49,108,999 T249A probably benign Het
Igfn1 C A 1: 135,962,008 V2434F probably damaging Het
Khdrbs2 T C 1: 32,333,604 S120P unknown Het
Lmx1a T C 1: 167,692,040 F46L probably damaging Het
Lrba C G 3: 86,325,074 T776R probably damaging Het
Lrrc8c A G 5: 105,607,835 N492S possibly damaging Het
Mapk3 A T 7: 126,764,795 I365F Het
Mcee A G 7: 64,411,909 I153M possibly damaging Het
Mllt3 T C 4: 87,791,943 D415G possibly damaging Het
Muc4 A T 16: 32,755,366 T1747S unknown Het
Myh14 A T 7: 44,661,042 V139E probably damaging Het
Myo10 A T 15: 25,779,620 I772L probably benign Het
Nbeal1 T A 1: 60,244,810 I841N probably damaging Het
Nf1 C T 11: 79,546,276 T2006I probably damaging Het
Npr2 T A 4: 43,641,254 W427R probably damaging Het
Nr1h3 A T 2: 91,190,195 F324L possibly damaging Het
Obscn T C 11: 59,056,914 K4430E Het
Olfr203 A G 16: 59,304,028 R292G probably damaging Het
Olfr213 T C 6: 116,540,933 L160P probably benign Het
Olfr791 A T 10: 129,526,661 T145S probably benign Het
Osgin1 T A 8: 119,445,431 H321Q probably benign Het
P4ha1 A G 10: 59,350,451 I251V probably benign Het
Padi2 G A 4: 140,917,686 W77* probably null Het
Pkd1 T A 17: 24,581,642 I3086N probably damaging Het
Plk3 T C 4: 117,131,153 N360S probably benign Het
Prr14 A T 7: 127,476,442 S541C probably null Het
Ptch2 C A 4: 117,114,646 Q1122K possibly damaging Het
Rab3gap1 T C 1: 127,937,990 V764A possibly damaging Het
Rad50 T C 11: 53,695,396 I258V probably benign Het
Rapgef3 G T 15: 97,766,791 R64S probably benign Het
Rbm44 A G 1: 91,152,216 N42S possibly damaging Het
Ring1 T C 17: 34,021,720 Y361C probably damaging Het
Robo3 T C 9: 37,418,556 T1155A probably damaging Het
Rsf1 GGCGG GGCGGTGGCCGCGG 7: 97,579,915 probably benign Het
Ryr3 T C 2: 112,640,157 T4682A probably damaging Het
Sema7a T C 9: 57,961,564 V653A unknown Het
Slc16a13 T C 11: 70,219,279 Y132C probably damaging Het
Slc24a1 A G 9: 64,948,533 V364A unknown Het
Slc8a2 C T 7: 16,134,353 A170V probably damaging Het
Slfn8 C T 11: 83,003,740 R691Q not run Het
Snx2 T C 18: 53,194,568 V122A probably benign Het
Sstr1 A T 12: 58,213,280 M230L probably benign Het
Themis2 C T 4: 132,786,217 V233I possibly damaging Het
Tmem106b T C 6: 13,078,168 S121P probably damaging Het
Tmem63c A G 12: 87,077,948 I529V probably benign Het
Tmem94 T C 11: 115,796,145 probably null Het
Trmt10c A T 16: 56,034,256 W339R probably damaging Het
Ugt2b1 A T 5: 86,917,719 F487Y not run Het
Vmn2r91 T A 17: 18,136,576 L835* probably null Het
Vps52 C A 17: 33,958,309 N108K possibly damaging Het
Wdpcp T A 11: 21,711,585 C286S possibly damaging Het
Zfp959 T A 17: 55,898,551 H529Q possibly damaging Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2061:Kdm5a UTSW 6 120381617 missense probably benign
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R3923:Kdm5a UTSW 6 120381664 missense probably benign 0.01
R4013:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6110:Kdm5a UTSW 6 120412306 missense probably damaging 1.00
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6612:Kdm5a UTSW 6 120430228 missense probably damaging 0.99
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7411:Kdm5a UTSW 6 120426815 missense probably damaging 1.00
R7521:Kdm5a UTSW 6 120432187 nonsense probably null
R7570:Kdm5a UTSW 6 120427842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATTGAAATTGGGAGTTTCTCTG -3'
(R):5'- GGTCATGAGACTGAGGCAAC -3'

Sequencing Primer
(F):5'- GGGAGTTTCTCTGATATTTTTCCC -3'
(R):5'- TCAGGTCTGCTAAGTACATGGAC -3'
Posted On2019-09-13