Incidental Mutation 'R7381:Fxr2'
ID572746
Institutional Source Beutler Lab
Gene Symbol Fxr2
Ensembl Gene ENSMUSG00000018765
Gene Namefragile X mental retardation, autosomal homolog 2
SynonymsFxr2h
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.684) question?
Stock #R7381 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location69632990-69653297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69642049 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 151 (C151Y)
Ref Sequence ENSEMBL: ENSMUSP00000018909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018909]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018909
AA Change: C151Y

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765
AA Change: C151Y

DomainStartEndE-ValueType
Pfam:Agenet 72 130 1.3e-10 PFAM
KH 227 294 3.06e-3 SMART
KH 295 366 4.16e-5 SMART
low complexity region 368 380 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 475 503 N/A INTRINSIC
Pfam:FXR_C1 504 579 2.5e-36 PFAM
low complexity region 586 599 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a RNA binding protein containing two KH domains and one RCG box, which is similar to FMRP and FXR1. It associates with polyribosomes, predominantly with 60S large ribosomal subunits. This encoded protein may self-associate or interact with FMRP and FXR1. It may have a role in the development of fragile X mental retardation syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hyperactivity, impaired Morris water task performance, and reductions in prepulse inhibition, contextual conditioned fear, and sensitivity to heat stimulus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016K19Rik A T 11: 76,003,007 D70V probably damaging Het
4930550C14Rik T C 9: 53,411,822 Y53H probably damaging Het
Acads C A 5: 115,110,998 Q365H probably damaging Het
Acsm3 A G 7: 119,780,826 D462G probably damaging Het
Adam39 T A 8: 40,825,963 C464S probably damaging Het
Adgra3 A G 5: 50,058,774 M1T probably null Het
AI182371 T C 2: 35,085,359 Y276C probably damaging Het
Ank2 T A 3: 126,936,628 H719L possibly damaging Het
Ano7 G A 1: 93,395,335 V466I probably benign Het
Art5 A G 7: 102,098,170 L134P probably damaging Het
Atcay A G 10: 81,210,597 Y298H possibly damaging Het
Atp1a4 A T 1: 172,240,115 F527Y possibly damaging Het
Bpifb2 A T 2: 153,892,348 M428L probably benign Het
Brinp2 A C 1: 158,246,343 V736G probably benign Het
Cdc5l C T 17: 45,411,923 A437T probably benign Het
Cdx2 G A 5: 147,306,630 P118L possibly damaging Het
Creb3l2 T A 6: 37,335,848 E417V probably damaging Het
Csnk2a1 A G 2: 152,258,694 T129A probably benign Het
Dennd6b A T 15: 89,186,173 L431Q possibly damaging Het
Dgkz C T 2: 91,944,835 A260T probably benign Het
Dhx34 T A 7: 16,215,448 T352S probably benign Het
Elp4 C T 2: 105,792,307 R349Q not run Het
Emsy A C 7: 98,590,803 F1228V probably damaging Het
Faf1 T A 4: 109,861,937 D413E probably damaging Het
Fam71e2 C A 7: 4,757,682 R677L Het
Fat3 T C 9: 16,246,987 Y1109C probably damaging Het
Fbp1 T C 13: 62,865,053 K314E probably benign Het
Fbxl20 A G 11: 98,090,788 V358A probably benign Het
Gja8 T C 3: 96,920,022 D108G probably benign Het
Grsf1 A G 5: 88,665,807 V361A probably benign Het
Gsap T A 5: 21,226,787 I228N probably damaging Het
Hagh T C 17: 24,856,712 I131T probably damaging Het
Heca A T 10: 17,915,524 Y261* probably null Het
Hipk3 A G 2: 104,439,351 F498L probably damaging Het
Hps4 T A 5: 112,375,458 I614N possibly damaging Het
Icam1 T C 9: 21,027,590 S450P probably benign Het
Il22 G A 10: 118,205,164 M58I possibly damaging Het
Khdrbs2 T A 1: 32,333,802 S186T not run Het
Kif16b A G 2: 142,857,423 F79S probably damaging Het
Kntc1 C A 5: 123,810,908 F1905L probably benign Het
Lrp1b C T 2: 40,802,917 G3423D Het
Lrp5 G T 19: 3,593,588 Q1346K probably benign Het
Map3k21 A C 8: 125,944,978 T1002P possibly damaging Het
Mdga2 G T 12: 66,568,896 R646S probably benign Het
Mex3b G T 7: 82,868,865 M129I possibly damaging Het
Mfsd10 G T 5: 34,636,426 N85K probably damaging Het
Mios A G 6: 8,216,064 D420G probably damaging Het
Mogs C A 6: 83,115,632 P18T unknown Het
Mrgpre A G 7: 143,781,413 C118R probably damaging Het
Muc4 A T 16: 32,780,915 H1321L Het
Nkapl T C 13: 21,467,589 K285E probably damaging Het
Nphp4 C T 4: 152,499,003 P200S possibly damaging Het
Piezo1 A G 8: 122,501,658 F297L Het
Pkhd1 T G 1: 20,200,973 S3119R probably damaging Het
Pla2g15 G A 8: 106,162,944 V283I probably benign Het
Ppp1r13l T A 7: 19,368,861 probably null Het
Prex1 A G 2: 166,587,127 Y849H probably damaging Het
Psg27 C A 7: 18,567,083 W15L probably benign Het
Ptpn6 G A 6: 124,728,172 R264C probably damaging Het
Ptprb A G 10: 116,341,133 I988V probably benign Het
Ptpro G A 6: 137,399,561 V680I possibly damaging Het
Rnf170 C T 8: 26,123,848 P28S probably benign Het
Rnpepl1 A G 1: 92,919,195 S580G possibly damaging Het
Rtel1 C T 2: 181,330,815 R29* probably null Het
Rtkn T C 6: 83,151,745 L26P probably damaging Het
Sdk2 A C 11: 113,838,489 S1087R probably damaging Het
Sema7a C T 9: 57,953,569 P71L probably benign Het
Sgpp1 C T 12: 75,716,264 C381Y probably damaging Het
Slc24a5 A C 2: 125,068,949 D100A probably benign Het
Slc25a23 A T 17: 57,053,587 I251K probably damaging Het
Slc6a5 T A 7: 49,930,056 L394H probably damaging Het
Slc7a4 A T 16: 17,575,056 M293K probably damaging Het
Syne2 T A 12: 75,926,489 S1089T probably benign Het
Tanc1 A T 2: 59,785,326 T226S probably damaging Het
Tdrd6 T C 17: 43,626,093 T1355A probably benign Het
Tmem101 A G 11: 102,153,350 M237T possibly damaging Het
Ttn G A 2: 76,919,015 H3897Y possibly damaging Het
Tubb4a C T 17: 57,080,698 V443M unknown Het
Ucp2 G A 7: 100,498,369 R185H possibly damaging Het
Vmn1r116 G T 7: 20,872,511 E86* probably null Het
Vmn2r37 T C 7: 9,210,033 E530G probably benign Het
Vwa8 A G 14: 79,095,685 T1293A probably benign Het
Zfc3h1 T A 10: 115,424,630 Y1711N probably benign Het
Zfp873 A T 10: 82,060,971 E512V probably damaging Het
Zfyve16 T A 13: 92,521,146 K752N probably damaging Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Other mutations in Fxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00469:Fxr2 APN 11 69642139 missense possibly damaging 0.77
IGL00595:Fxr2 APN 11 69649192 missense probably benign 0.01
IGL00659:Fxr2 APN 11 69640250 missense probably benign 0.12
IGL00921:Fxr2 APN 11 69652240 missense probably damaging 1.00
IGL01025:Fxr2 APN 11 69643887 missense probably damaging 1.00
IGL01154:Fxr2 APN 11 69641433 splice site probably benign
IGL01347:Fxr2 APN 11 69652288 missense probably benign 0.27
IGL01743:Fxr2 APN 11 69652622 missense possibly damaging 0.53
IGL01981:Fxr2 APN 11 69650502 missense possibly damaging 0.95
IGL02332:Fxr2 APN 11 69649838 critical splice donor site probably null
IGL02385:Fxr2 APN 11 69652269 missense possibly damaging 0.82
IGL03172:Fxr2 APN 11 69649839 critical splice donor site probably null
R0092:Fxr2 UTSW 11 69642146 splice site probably benign
R0720:Fxr2 UTSW 11 69639415 missense probably benign 0.03
R1112:Fxr2 UTSW 11 69652248 missense probably damaging 1.00
R1344:Fxr2 UTSW 11 69648884 missense possibly damaging 0.68
R1635:Fxr2 UTSW 11 69641313 missense possibly damaging 0.77
R1864:Fxr2 UTSW 11 69652277 missense probably benign 0.30
R1957:Fxr2 UTSW 11 69643940 missense probably benign 0.03
R1992:Fxr2 UTSW 11 69649833 missense possibly damaging 0.92
R2243:Fxr2 UTSW 11 69642070 missense possibly damaging 0.93
R2863:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R2865:Fxr2 UTSW 11 69639427 missense probably damaging 1.00
R5255:Fxr2 UTSW 11 69643841 missense probably benign 0.03
R5726:Fxr2 UTSW 11 69633346 missense probably benign 0.00
R5899:Fxr2 UTSW 11 69652685 missense probably damaging 1.00
R6045:Fxr2 UTSW 11 69651051 missense possibly damaging 0.90
R6146:Fxr2 UTSW 11 69641339 missense possibly damaging 0.82
R6149:Fxr2 UTSW 11 69649204 missense probably benign 0.05
R6195:Fxr2 UTSW 11 69652273 missense probably benign 0.30
R6622:Fxr2 UTSW 11 69641590 critical splice donor site probably null
R7382:Fxr2 UTSW 11 69641556 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGCTATGCCCATAACCCTC -3'
(R):5'- TCGAGCATGAGCAAAAGCC -3'

Sequencing Primer
(F):5'- CAGACTTGCTTTGCAGTCACAGAG -3'
(R):5'- GAGCAAAAGCCATATATCCACTTTTC -3'
Posted On2019-09-13