Incidental Mutation 'R7383:Myo1e'
ID572881
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70297295 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 59 (V59D)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000034745
AA Change: V59D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: V59D

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000214042
AA Change: V59D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Jmjd1c A T 10: 67,189,758 N118I probably benign Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4995:Myo1e UTSW 9 70353272 missense probably benign 0.01
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGAGCTGATTGAATAACTGC -3'
(R):5'- GTCTGTACTTTGAGCTGCATGC -3'

Sequencing Primer
(F):5'- GAGCTGATTGAATAACTGCTTCTTC -3'
(R):5'- TACCGCTCCTTGGTACAT -3'
Posted On2019-09-13