Incidental Mutation 'R7383:Jmjd1c'
ID572883
Institutional Source Beutler Lab
Gene Symbol Jmjd1c
Ensembl Gene ENSMUSG00000037876
Gene Namejumonji domain containing 1C
SynonymsTRIP8, D630035I23Rik, 5430433L24Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R7383 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location67096125-67256326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67189758 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 118 (N118I)
Ref Sequence ENSEMBL: ENSMUSP00000134551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051446] [ENSMUST00000173689] [ENSMUST00000174317] [ENSMUST00000174408]
Predicted Effect probably benign
Transcript: ENSMUST00000051446
AA Change: N118I

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000056227
Gene: ENSMUSG00000037876
AA Change: N118I

DomainStartEndE-ValueType
Blast:JmjC 143 2236 N/A BLAST
JmjC 2264 2488 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173689
SMART Domains Protein: ENSMUSP00000133700
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 1 2056 N/A BLAST
JmjC 2084 2308 3.29e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174317
SMART Domains Protein: ENSMUSP00000134246
Gene: ENSMUSG00000037876

DomainStartEndE-ValueType
Blast:JmjC 1 744 N/A BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174408
AA Change: N118I

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000134551
Gene: ENSMUSG00000037876
AA Change: N118I

DomainStartEndE-ValueType
Blast:JmjC 143 2237 N/A BLAST
JmjC 2265 2489 3.29e-53 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with thyroid hormone receptors and contains a jumonji domain. It is a candidate histone demethylase and is thought to be a coactivator for key transcription factors. It plays a role in the DNA-damage response pathway by demethylating the mediator of DNA damage checkpoint 1 (MDC1) protein, and is required for the survival of acute myeloid leukemia. Mutations in this gene are associated with Rett syndrome and intellectual disability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit an age-dependent male infertility phenotype, characterized by early loss of undifferentiated spermatogonia, and a progressive reduction in testis size/weight and male germ cells, partly due to increased male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 T A 11: 5,868,548 I511N probably damaging Het
Ap5m1 T G 14: 49,074,196 V241G possibly damaging Het
BC049715 T A 6: 136,840,455 I231N probably damaging Het
Bckdhb T G 9: 83,953,713 V90G possibly damaging Het
Chd8 T C 14: 52,215,319 I1248V probably damaging Het
Ckap2l A T 2: 129,269,252 M675K possibly damaging Het
Ckap4 A T 10: 84,528,284 V305E probably damaging Het
Clasrp C A 7: 19,585,273 R489L unknown Het
Col24a1 A G 3: 145,298,838 I26V probably benign Het
Cort C T 4: 149,125,404 A64T possibly damaging Het
Dmkn T A 7: 30,765,368 N255K unknown Het
Dph2 A T 4: 117,891,369 L69Q probably damaging Het
Fam129c A C 8: 71,603,826 E390A possibly damaging Het
Fbxo11 A G 17: 88,002,854 I432T Het
Fgd3 T C 13: 49,268,309 K531R possibly damaging Het
Fgd5 A G 6: 91,987,118 K111E probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gdf6 T A 4: 9,859,537 D206E probably benign Het
Gtpbp1 T A 15: 79,716,153 L429Q probably damaging Het
Hk2 A G 6: 82,749,295 F90S probably damaging Het
Hrnr A T 3: 93,331,791 Q3112L unknown Het
Hsd17b4 A C 18: 50,164,850 K402T probably benign Het
Htr1f T C 16: 64,926,843 T29A probably benign Het
Ikbkb C A 8: 22,669,050 A471S probably benign Het
Inpp5f A G 7: 128,694,586 D887G probably damaging Het
Ipo9 A G 1: 135,388,673 L805P probably damaging Het
Kif26b T G 1: 178,530,710 C129G probably damaging Het
Mga G A 2: 119,960,340 A2236T probably damaging Het
Micu2 T C 14: 57,917,353 Q405R possibly damaging Het
Myo1e T A 9: 70,297,295 V59D probably damaging Het
Nav3 A G 10: 109,716,671 I1770T probably damaging Het
Ndufa10 A T 1: 92,464,461 I190N probably damaging Het
Npat T A 9: 53,562,778 H623Q probably benign Het
Npc1l1 T C 11: 6,217,777 T1005A probably benign Het
Olfr1086 A G 2: 86,676,919 V138A possibly damaging Het
Olfr1124 A G 2: 87,435,377 S297G possibly damaging Het
Olfr124 A G 17: 37,806,081 K312R probably benign Het
Olfr281 C G 15: 98,456,697 P129R probably damaging Het
Olfr292 A T 7: 86,694,752 I99F probably damaging Het
Olfr322 T C 11: 58,666,185 S209P possibly damaging Het
Olfr381 A G 11: 73,485,889 *312Q probably null Het
Pafah1b2 C T 9: 45,968,849 G177R probably benign Het
Phc1 A G 6: 122,323,358 S521P unknown Het
Plpp2 A T 10: 79,531,007 L25Q probably null Het
Plxna4 A G 6: 32,152,799 probably null Het
Ppl G T 16: 5,097,971 P576Q probably damaging Het
Rab38 T C 7: 88,430,429 Y10H possibly damaging Het
Rbfox1 G A 16: 7,070,035 G13S probably benign Het
Rhot1 C G 11: 80,223,934 P56R probably damaging Het
Sipa1l2 A G 8: 125,447,646 W1298R probably damaging Het
Slc16a14 G A 1: 84,912,571 H338Y probably damaging Het
Slc8a3 T G 12: 81,315,805 Y80S probably damaging Het
Slco6c1 A T 1: 97,075,883 Y513* probably null Het
Smarcd2 A G 11: 106,264,776 C405R probably damaging Het
Szt2 G A 4: 118,365,214 R3198* probably null Het
Tmeff1 T A 4: 48,636,841 C180S probably damaging Het
Tmem132a A T 19: 10,866,994 M80K probably benign Het
Tnfsf12 A G 11: 69,687,066 V175A probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Togaram2 A T 17: 71,700,517 I354F probably damaging Het
Uchl5 T A 1: 143,784,015 S42R probably benign Het
Virma C A 4: 11,514,026 L627I probably damaging Het
Vmn2r12 A T 5: 109,092,818 I143K probably benign Het
Vmn2r95 T G 17: 18,440,472 V382G probably benign Het
Wipf3 G T 6: 54,485,278 A158S probably benign Het
Ylpm1 T G 12: 85,044,468 S1809A possibly damaging Het
Zdhhc5 A T 2: 84,694,404 C191S probably benign Het
Zer1 G A 2: 30,111,241 R84C probably damaging Het
Zfhx2 A T 14: 55,068,253 V991D probably benign Het
Zscan4b C A 7: 10,904,033 M61I possibly damaging Het
Zswim2 A T 2: 83,915,328 S589T possibly damaging Het
Other mutations in Jmjd1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01062:Jmjd1c APN 10 67226715 missense probably damaging 1.00
IGL01604:Jmjd1c APN 10 67249762 missense probably damaging 1.00
IGL01753:Jmjd1c APN 10 67232015 missense probably damaging 1.00
IGL02081:Jmjd1c APN 10 67219526 missense probably benign 0.02
IGL02128:Jmjd1c APN 10 67243869 missense probably damaging 1.00
IGL02134:Jmjd1c APN 10 67220392 missense possibly damaging 0.87
IGL02215:Jmjd1c APN 10 67220322 missense probably damaging 1.00
IGL02408:Jmjd1c APN 10 67226382 missense probably benign 0.00
IGL02502:Jmjd1c APN 10 67225861 missense probably benign 0.13
IGL02546:Jmjd1c APN 10 67225336 missense possibly damaging 0.94
IGL02943:Jmjd1c APN 10 67219654 missense probably damaging 0.99
IGL03171:Jmjd1c APN 10 67225498 missense possibly damaging 0.89
IGL03261:Jmjd1c APN 10 67232070 missense probably damaging 0.99
accordion UTSW 10 67233414 missense probably damaging 0.99
PIT4378001:Jmjd1c UTSW 10 67229913 missense probably damaging 1.00
R0126:Jmjd1c UTSW 10 67219326 missense probably damaging 0.98
R0133:Jmjd1c UTSW 10 67240808 missense probably benign 0.22
R0201:Jmjd1c UTSW 10 67219109 missense unknown
R0396:Jmjd1c UTSW 10 67219523 missense possibly damaging 0.82
R0401:Jmjd1c UTSW 10 67220382 missense probably damaging 1.00
R0452:Jmjd1c UTSW 10 67255482 missense probably benign 0.28
R0488:Jmjd1c UTSW 10 67240727 missense probably damaging 0.99
R0504:Jmjd1c UTSW 10 67225755 missense probably damaging 1.00
R0555:Jmjd1c UTSW 10 67225789 missense probably benign 0.01
R0673:Jmjd1c UTSW 10 67226809 missense probably damaging 1.00
R0718:Jmjd1c UTSW 10 67218946 splice site probably null
R0755:Jmjd1c UTSW 10 67096599 intron probably benign
R1142:Jmjd1c UTSW 10 67225345 missense probably damaging 1.00
R1196:Jmjd1c UTSW 10 67239236 splice site probably benign
R1413:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R1619:Jmjd1c UTSW 10 67219875 missense probably benign 0.25
R1676:Jmjd1c UTSW 10 67224809 missense probably benign 0.02
R1751:Jmjd1c UTSW 10 67225690 missense probably benign
R1950:Jmjd1c UTSW 10 67239922 missense possibly damaging 0.71
R1968:Jmjd1c UTSW 10 67225440 missense probably damaging 1.00
R2049:Jmjd1c UTSW 10 67157998 nonsense probably null
R2061:Jmjd1c UTSW 10 67218426 missense probably damaging 1.00
R2202:Jmjd1c UTSW 10 67239463 splice site probably null
R2203:Jmjd1c UTSW 10 67239463 splice site probably null
R2256:Jmjd1c UTSW 10 67225294 missense probably damaging 1.00
R2312:Jmjd1c UTSW 10 67238850 missense probably damaging 0.98
R2349:Jmjd1c UTSW 10 67255500 missense probably benign
R2392:Jmjd1c UTSW 10 67229904 missense probably damaging 1.00
R3015:Jmjd1c UTSW 10 67157932 missense probably damaging 1.00
R3110:Jmjd1c UTSW 10 67240084 splice site probably benign
R4043:Jmjd1c UTSW 10 67219466 missense possibly damaging 0.55
R4097:Jmjd1c UTSW 10 67219008 missense probably benign 0.09
R4118:Jmjd1c UTSW 10 67219753 missense probably damaging 0.96
R4193:Jmjd1c UTSW 10 67096681 intron probably benign
R4352:Jmjd1c UTSW 10 67244809 missense probably damaging 1.00
R4577:Jmjd1c UTSW 10 67249750 missense probably damaging 1.00
R4630:Jmjd1c UTSW 10 67157974 nonsense probably null
R4717:Jmjd1c UTSW 10 67158051 nonsense probably null
R4741:Jmjd1c UTSW 10 67224939 missense possibly damaging 0.56
R4774:Jmjd1c UTSW 10 67224792 missense possibly damaging 0.45
R4836:Jmjd1c UTSW 10 67233446 missense probably benign 0.21
R4914:Jmjd1c UTSW 10 67218971 missense probably damaging 1.00
R4939:Jmjd1c UTSW 10 67246137 missense possibly damaging 0.93
R5211:Jmjd1c UTSW 10 67232016 missense probably damaging 1.00
R5215:Jmjd1c UTSW 10 67240701 missense possibly damaging 0.93
R5514:Jmjd1c UTSW 10 67218149 missense probably damaging 1.00
R5530:Jmjd1c UTSW 10 67249762 missense probably damaging 1.00
R5624:Jmjd1c UTSW 10 67233414 missense probably damaging 0.99
R5640:Jmjd1c UTSW 10 67226078 missense probably benign 0.10
R5654:Jmjd1c UTSW 10 67230006 missense probably benign 0.10
R5742:Jmjd1c UTSW 10 67220333 missense probably benign 0.02
R5764:Jmjd1c UTSW 10 67226512 missense probably damaging 1.00
R6118:Jmjd1c UTSW 10 67240012 missense probably damaging 1.00
R6163:Jmjd1c UTSW 10 67248048 missense possibly damaging 0.46
R6256:Jmjd1c UTSW 10 67220408 missense probably damaging 1.00
R6266:Jmjd1c UTSW 10 67249660 missense probably damaging 0.96
R6358:Jmjd1c UTSW 10 67225939 missense probably benign
R6430:Jmjd1c UTSW 10 67224160 missense possibly damaging 0.87
R6455:Jmjd1c UTSW 10 67226016 missense probably benign 0.10
R6887:Jmjd1c UTSW 10 67189820 missense possibly damaging 0.74
R6895:Jmjd1c UTSW 10 67217090 missense probably benign 0.00
R7041:Jmjd1c UTSW 10 67220609 missense possibly damaging 0.90
R7095:Jmjd1c UTSW 10 67219632 missense probably benign 0.39
R7113:Jmjd1c UTSW 10 67158001 missense probably damaging 0.98
R7225:Jmjd1c UTSW 10 67226065 missense probably benign 0.00
R7249:Jmjd1c UTSW 10 67189817 missense probably benign 0.01
R7361:Jmjd1c UTSW 10 67218364 missense probably benign 0.10
R7460:Jmjd1c UTSW 10 67217036 missense probably benign 0.24
R7475:Jmjd1c UTSW 10 67225313 missense probably benign 0.22
R7502:Jmjd1c UTSW 10 67232015 missense not run
Z1088:Jmjd1c UTSW 10 67238174 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAACATACACGTGTGCTTGG -3'
(R):5'- AGTCCCAGCACAAATTTATTGC -3'

Sequencing Primer
(F):5'- GAAACATACACGTGTGCTTGGTAGTC -3'
(R):5'- AGCACAAATTTATTGCTAAGTAATGC -3'
Posted On2019-09-13