Incidental Mutation 'R7384:Rab11fip5'
ID572937
Institutional Source Beutler Lab
Gene Symbol Rab11fip5
Ensembl Gene ENSMUSG00000051343
Gene NameRAB11 family interacting protein 5 (class I)
SynonymsRIP11, D6Ertd32e, GAF1, 9130206P09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7384 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location85334962-85374634 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85348330 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 332 (S332T)
Ref Sequence ENSEMBL: ENSMUSP00000145402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060837] [ENSMUST00000204087]
Predicted Effect probably benign
Transcript: ENSMUST00000060837
AA Change: S332T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000058305
Gene: ENSMUSG00000051343
AA Change: S332T

DomainStartEndE-ValueType
C2 20 143 8.7e-7 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
Pfam:RBD-FIP 593 640 5.1e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000204087
AA Change: S332T

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145402
Gene: ENSMUSG00000051343
AA Change: S332T

DomainStartEndE-ValueType
C2 20 143 5.8e-9 SMART
low complexity region 248 265 N/A INTRINSIC
low complexity region 313 322 N/A INTRINSIC
low complexity region 356 391 N/A INTRINSIC
low complexity region 529 547 N/A INTRINSIC
low complexity region 560 568 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 687 692 N/A INTRINSIC
low complexity region 713 732 N/A INTRINSIC
low complexity region 852 887 N/A INTRINSIC
low complexity region 893 901 N/A INTRINSIC
low complexity region 1037 1052 N/A INTRINSIC
low complexity region 1068 1106 N/A INTRINSIC
low complexity region 1115 1149 N/A INTRINSIC
Pfam:RBD-FIP 1266 1313 8.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a floxed allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5330417C22Rik A T 3: 108,463,468 probably null Het
Abca13 C A 11: 9,333,257 S3226R probably damaging Het
Abhd14b A G 9: 106,450,141 I41V probably benign Het
Acot2 T C 12: 83,992,667 S317P probably benign Het
Acp7 T C 7: 28,615,088 E284G possibly damaging Het
Adamts5 A G 16: 85,899,826 F148L probably benign Het
Adcy10 C T 1: 165,576,608 P1611S unknown Het
Agr2 A G 12: 35,995,924 T57A probably damaging Het
Ankar T G 1: 72,658,465 I1060L probably benign Het
Ano10 T A 9: 122,176,343 D77V unknown Het
Apc2 G A 10: 80,312,624 V1171I probably damaging Het
Apoa4 G A 9: 46,241,474 R19Q not run Het
Arhgap33 A G 7: 30,527,271 S504P probably damaging Het
Atg2a T C 19: 6,261,677 V1862A probably damaging Het
Atp7b T C 8: 22,022,315 S511G probably benign Het
Bcl10 A G 3: 145,933,040 K146E possibly damaging Het
Bsg A T 10: 79,709,797 D181V probably damaging Het
Btg4 T C 9: 51,119,113 V171A probably benign Het
Cdh8 A C 8: 99,230,506 N188K probably benign Het
Cflar C A 1: 58,752,576 T346K Het
Chrna5 T C 9: 55,004,833 S306P probably damaging Het
Cldn20 G A 17: 3,532,611 G20R probably damaging Het
Clns1a G A 7: 97,696,781 A18T probably benign Het
D130043K22Rik A G 13: 24,882,605 Y795C probably damaging Het
Dync1li2 A C 8: 104,442,543 S38A probably benign Het
Dysf A G 6: 84,114,105 E1043G probably benign Het
Eral1 A G 11: 78,074,101 I422T possibly damaging Het
Exoc3 G A 13: 74,172,156 P729S probably benign Het
Eya1 T A 1: 14,229,512 Y339F probably damaging Het
Faah G T 4: 116,005,167 N206K probably damaging Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Gcc2 T A 10: 58,269,964 S341T probably damaging Het
Gfpt2 A T 11: 49,810,990 I123F possibly damaging Het
Gm21188 T A 13: 120,035,261 Q24L possibly damaging Het
Gm3047 T A 14: 4,558,271 N164K probably damaging Het
Gm3327 A G 14: 44,124,877 K78E Het
Gm438 T A 4: 144,780,621 I65F possibly damaging Het
Herpud1 A G 8: 94,389,377 I57V probably damaging Het
Homer1 A T 13: 93,393,039 R285S possibly damaging Het
Hps6 T A 19: 46,004,017 V131E possibly damaging Het
Il1r1 T A 1: 40,282,261 I11N possibly damaging Het
Jakmip1 T A 5: 37,173,207 D410E possibly damaging Het
Kif3a T A 11: 53,578,854 F97L probably damaging Het
Klf11 C T 12: 24,653,743 T76I probably damaging Het
Ldlr A C 9: 21,739,794 T503P probably benign Het
Mapk3 G C 7: 126,764,291 R279P Het
Mb21d2 A T 16: 28,828,912 D103E probably benign Het
Mfsd7a A T 5: 108,446,060 I61K probably damaging Het
Msh4 T A 3: 153,888,748 M333L probably benign Het
Mycbp2 A G 14: 103,276,393 I836T probably damaging Het
Myh1 A T 11: 67,224,375 E1912V possibly damaging Het
Ncapd2 A G 6: 125,173,401 V887A probably benign Het
Nlrp4a G A 7: 26,449,538 R190Q not run Het
Nop53 T C 7: 15,939,495 T344A probably damaging Het
Olfr235 T C 19: 12,269,076 V282A possibly damaging Het
Olfr457 A T 6: 42,471,323 L285Q possibly damaging Het
Olfr871 A G 9: 20,212,745 Y132C probably damaging Het
Pcyox1l A C 18: 61,698,390 V266G probably damaging Het
Pde5a A G 3: 122,825,000 Y654C probably damaging Het
Polq T C 16: 37,029,418 S345P probably damaging Het
Prdm1 A T 10: 44,458,507 C8S probably benign Het
Psg17 T A 7: 18,818,660 Q230L possibly damaging Het
Rac2 T A 15: 78,561,931 K186* probably null Het
S100pbp T C 4: 129,181,909 N208D probably benign Het
Scaf11 A T 15: 96,420,387 V432D possibly damaging Het
Slc34a1 G T 13: 55,402,934 C225F probably benign Het
Slc35e2 A T 4: 155,610,632 M152L probably benign Het
Slc9a4 T A 1: 40,612,251 I563K probably benign Het
Sppl3 T G 5: 115,061,641 probably null Het
Stam T C 2: 14,134,430 F301L probably benign Het
Supt16 G A 14: 52,181,162 R213W probably damaging Het
Tbc1d8 A T 1: 39,394,098 D334E probably benign Het
Tmem87a C T 2: 120,371,523 probably null Het
Tnk1 T C 11: 69,851,621 Y661C probably damaging Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Tnxb A G 17: 34,718,518 D2947G probably damaging Het
Traf4 A G 11: 78,160,791 probably null Het
Trappc10 A T 10: 78,209,384 M490K possibly damaging Het
Trav12-1 A G 14: 53,538,536 T49A probably benign Het
Ttc37 A C 13: 76,150,735 S1187R possibly damaging Het
Twistnb G T 12: 33,433,632 G128W probably damaging Het
Ubap1l AGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGA 9: 65,371,750 probably benign Het
Unc79 G T 12: 103,171,578 V2485L probably benign Het
Ush2a T C 1: 188,400,163 S861P probably damaging Het
Vcam1 A G 3: 116,117,228 V507A possibly damaging Het
Vmn1r218 A G 13: 23,136,725 M81V probably benign Het
Zfp652 G T 11: 95,753,004 V343L probably damaging Het
Other mutations in Rab11fip5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rab11fip5 APN 6 85337552 missense probably damaging 1.00
IGL02471:Rab11fip5 APN 6 85348225 missense probably damaging 0.99
IGL02725:Rab11fip5 APN 6 85374489 missense probably damaging 0.99
IGL02737:Rab11fip5 APN 6 85348558 missense probably damaging 1.00
PIT4812001:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R0627:Rab11fip5 UTSW 6 85348051 missense probably benign 0.05
R1652:Rab11fip5 UTSW 6 85348297 missense probably damaging 0.97
R1961:Rab11fip5 UTSW 6 85348991 missense possibly damaging 0.87
R2106:Rab11fip5 UTSW 6 85374387 missense probably damaging 0.98
R2142:Rab11fip5 UTSW 6 85337228 critical splice acceptor site probably null
R4729:Rab11fip5 UTSW 6 85374267 missense probably damaging 0.99
R5001:Rab11fip5 UTSW 6 85347806 missense probably damaging 1.00
R5116:Rab11fip5 UTSW 6 85348807 missense probably damaging 1.00
R5506:Rab11fip5 UTSW 6 85374137 missense probably damaging 1.00
R5801:Rab11fip5 UTSW 6 85337600 missense probably damaging 0.99
R6338:Rab11fip5 UTSW 6 85341378 missense possibly damaging 0.94
R6696:Rab11fip5 UTSW 6 85341946 missense possibly damaging 0.65
R6763:Rab11fip5 UTSW 6 85342170 missense probably benign 0.02
R6880:Rab11fip5 UTSW 6 85348845 missense probably damaging 0.99
R6932:Rab11fip5 UTSW 6 85341558 missense probably benign 0.38
R7042:Rab11fip5 UTSW 6 85374128 missense possibly damaging 0.82
R7112:Rab11fip5 UTSW 6 85348194 missense probably damaging 1.00
R7197:Rab11fip5 UTSW 6 85342155 missense probably damaging 1.00
R7395:Rab11fip5 UTSW 6 85341868 missense probably benign
R7451:Rab11fip5 UTSW 6 85341556 missense probably benign 0.06
R7482:Rab11fip5 UTSW 6 85340778 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- TGCCCCAAGAATCATCCGAG -3'
(R):5'- GACAGCACCTTGTCTTCCAC -3'

Sequencing Primer
(F):5'- TCATCCGAGGACCGAGAC -3'
(R):5'- ACTAGTGGCAGCCTGGTCTAC -3'
Posted On2019-09-13