Incidental Mutation 'R7385:Olfr1428'
ID573071
Institutional Source Beutler Lab
Gene Symbol Olfr1428
Ensembl Gene ENSMUSG00000067524
Gene Nameolfactory receptor 1428
SynonymsGA_x6K02T2RE5P-2468394-2467450, MOR239-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7385 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location12107716-12115897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 12108697 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 57 (N57S)
Ref Sequence ENSEMBL: ENSMUSP00000147015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087824] [ENSMUST00000208391] [ENSMUST00000214103]
Predicted Effect probably damaging
Transcript: ENSMUST00000087824
AA Change: N283S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085126
Gene: ENSMUSG00000067524
AA Change: N283S

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.1e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.2e-6 PFAM
Pfam:7tm_1 41 303 2.9e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000208391
AA Change: N57S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000214103
AA Change: N283S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T A 10: 82,287,737 E3146D probably benign Het
4932415D10Rik T C 10: 82,287,895 S3094G probably benign Het
Ahctf1 T C 1: 179,753,381 E1752G possibly damaging Het
Aqp3 T C 4: 41,095,178 T68A probably damaging Het
Arhgap40 A G 2: 158,543,227 K463R probably damaging Het
Asb10 A T 5: 24,533,738 C440* probably null Het
Bach1 A G 16: 87,729,497 T616A probably damaging Het
Braf T A 6: 39,665,108 probably null Het
Cacna1s A T 1: 136,092,633 N803Y probably damaging Het
Cald1 A G 6: 34,686,065 E21G probably damaging Het
Caskin1 G T 17: 24,503,924 G589C probably damaging Het
Cdc37l1 T C 19: 28,990,671 probably null Het
Cntnap5b G A 1: 100,379,090 G844D probably damaging Het
Col5a1 T C 2: 28,024,750 L1615P unknown Het
Cpt1a C A 19: 3,380,155 P672T probably damaging Het
Defb22 A G 2: 152,486,197 Y23H probably damaging Het
Depdc1b G C 13: 108,363,632 K226N probably damaging Het
Dnaja2 T C 8: 85,539,353 T368A probably benign Het
Dsg3 C A 18: 20,540,197 T975K possibly damaging Het
Eif4enif1 T A 11: 3,220,269 D107E probably damaging Het
Fut11 A G 14: 20,696,257 D389G probably damaging Het
Gopc C T 10: 52,349,232 G299E probably damaging Het
Gprin1 T C 13: 54,738,610 D617G probably benign Het
Grin2d A G 7: 45,857,536 V505A probably damaging Het
Heatr6 T C 11: 83,759,335 Y206H probably damaging Het
Hhex C A 19: 37,437,265 N147K probably damaging Het
Igkv4-80 G A 6: 69,016,715 S64F probably damaging Het
Jakmip3 A G 7: 139,023,339 K360R possibly damaging Het
Kat5 AG A 19: 5,608,269 probably null Het
Kat5 T A 19: 5,608,274 N191I probably benign Het
Kifc5b A G 17: 26,925,623 D572G probably damaging Het
Lrp5 C A 19: 3,612,197 probably null Het
Lrtm1 A G 14: 29,027,716 M345V probably benign Het
Mbd5 T C 2: 49,272,449 V981A probably benign Het
Mier3 G A 13: 111,705,249 G115S possibly damaging Het
Mrgprd A G 7: 145,321,524 N44S probably damaging Het
Mrps10 C A 17: 47,378,221 P181Q probably damaging Het
Myot T A 18: 44,337,008 C17* probably null Het
Ncoa6 C A 2: 155,407,801 L1194F probably damaging Het
Olfr1355 C A 10: 78,879,454 T94K probably damaging Het
Olfr1423 T C 19: 12,035,999 T248A probably benign Het
Olfr1507 T C 14: 52,490,181 Y261C probably damaging Het
Olfr58 T A 9: 19,783,211 I26N possibly damaging Het
Osbpl6 G A 2: 76,549,450 G128E probably damaging Het
P3h3 A T 6: 124,855,270 Y218N probably damaging Het
Paxip1 A G 5: 27,781,420 probably null Het
Pdia5 T C 16: 35,429,914 Y225C probably damaging Het
Pik3c2g T G 6: 139,855,353 M526R Het
Prox1 A G 1: 190,162,126 F41L probably benign Het
Psd3 A T 8: 68,000,756 F284I probably damaging Het
Rev3l T A 10: 39,823,682 C1392S probably benign Het
Rfxank A T 8: 70,134,635 V212E probably damaging Het
Ros1 T C 10: 52,155,126 D482G probably benign Het
Sat2 A T 11: 69,622,937 I94F probably damaging Het
Scarf2 T C 16: 17,803,838 L384P probably damaging Het
Sec14l2 C A 11: 4,116,750 E21* probably null Het
Slitrk5 T A 14: 111,680,699 V585E probably benign Het
Tas2r130 T A 6: 131,630,263 M190L probably benign Het
Ticrr G A 7: 79,691,849 S1061N possibly damaging Het
Tlr9 C A 9: 106,225,264 H585N probably damaging Het
Tmem219 A T 7: 126,896,775 I142N probably damaging Het
Tnni2 A G 7: 142,443,178 N8S probably benign Het
Tnpo2 G A 8: 85,050,119 R485H probably damaging Het
Ttc8 A G 12: 98,942,288 E72G possibly damaging Het
Upf1 A G 8: 70,340,618 Y297H probably damaging Het
Vmn1r4 A G 6: 56,956,736 K75R probably damaging Het
Vmn2r78 G A 7: 86,922,425 G481D probably benign Het
Vmn2r96 A G 17: 18,583,040 Y404C probably damaging Het
Vps50 T A 6: 3,602,708 S942T probably benign Het
Xkr7 C A 2: 153,054,063 S279* probably null Het
Zan G A 5: 137,434,154 Q2294* probably null Het
Zan T C 5: 137,450,491 Y1700C unknown Het
Other mutations in Olfr1428
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03062:Olfr1428 APN 19 12109148 missense probably benign 0.00
IGL02796:Olfr1428 UTSW 19 12108884 missense possibly damaging 0.85
PIT4495001:Olfr1428 UTSW 19 12108712 missense possibly damaging 0.65
R0541:Olfr1428 UTSW 19 12109520 missense possibly damaging 0.85
R1169:Olfr1428 UTSW 19 12109489 missense probably benign
R1918:Olfr1428 UTSW 19 12109507 missense probably benign 0.06
R2915:Olfr1428 UTSW 19 12108625 missense probably benign 0.09
R3835:Olfr1428 UTSW 19 12109400 missense possibly damaging 0.92
R4470:Olfr1428 UTSW 19 12109183 intron probably null
R4682:Olfr1428 UTSW 19 12108685 missense probably damaging 1.00
R4751:Olfr1428 UTSW 19 12109177 missense probably damaging 1.00
R5467:Olfr1428 UTSW 19 12108659 missense probably benign 0.20
R5513:Olfr1428 UTSW 19 12109381 missense probably damaging 1.00
R6915:Olfr1428 UTSW 19 12109126 missense probably benign 0.25
R7569:Olfr1428 UTSW 19 12109021 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TGTATCATAGAAGGCATATGGTGAC -3'
(R):5'- CTCAGATTCCATTCTGGGGAGG -3'

Sequencing Primer
(F):5'- GCTCACCCTAGCTTATTG -3'
(R):5'- GGACGGAACAAGGCTCTCTC -3'
Posted On2019-09-13