Incidental Mutation 'R0648:Fn1'
ID57311
Institutional Source Beutler Lab
Gene Symbol Fn1
Ensembl Gene ENSMUSG00000026193
Gene Namefibronectin 1
SynonymsFn-1, Fn
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0648 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location71585520-71653200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71597585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 2045 (V2045D)
Ref Sequence ENSEMBL: ENSMUSP00000140471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055226] [ENSMUST00000186129] [ENSMUST00000187627] [ENSMUST00000187938] [ENSMUST00000188674] [ENSMUST00000188894] [ENSMUST00000189821] [ENSMUST00000190780]
Predicted Effect probably benign
Transcript: ENSMUST00000055226
AA Change: V2136D

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000054499
Gene: ENSMUSG00000026193
AA Change: V2136D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1264 1346 4.22e-9 SMART
FN3 1357 1437 9.6e-13 SMART
FN3 1448 1527 1.82e-13 SMART
FN3 1538 1617 6.69e-12 SMART
FN3 1632 1711 2.72e-12 SMART
FN3 1722 1801 8.9e-8 SMART
FN3 1812 1891 1.66e-7 SMART
FN3 1904 1983 4.92e-10 SMART
FN3 1993 2074 3.64e-13 SMART
low complexity region 2148 2165 N/A INTRINSIC
FN3 2193 2272 2.9e0 SMART
FN1 2296 2340 3.72e-19 SMART
FN1 2341 2383 2.49e-20 SMART
FN1 2385 2425 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185408
Predicted Effect probably benign
Transcript: ENSMUST00000186129
AA Change: V1955D

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000141123
Gene: ENSMUSG00000026193
AA Change: V1955D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1967 1984 N/A INTRINSIC
FN3 2012 2091 2.9e0 SMART
FN1 2115 2159 3.72e-19 SMART
FN1 2160 2202 2.49e-20 SMART
FN1 2204 2244 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186985
Predicted Effect probably benign
Transcript: ENSMUST00000187627
SMART Domains Protein: ENSMUSP00000140955
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
Pfam:fn3 1 49 1.1e-6 PFAM
FN3 58 139 1.7e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000187938
AA Change: V2020D

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140975
Gene: ENSMUSG00000026193
AA Change: V2020D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2032 2049 N/A INTRINSIC
FN3 2077 2156 2.9e0 SMART
FN1 2180 2224 3.72e-19 SMART
FN1 2225 2267 2.49e-20 SMART
FN1 2269 2309 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188092
Predicted Effect probably benign
Transcript: ENSMUST00000188674
SMART Domains Protein: ENSMUSP00000140907
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1981 6.79e-13 SMART
FN3 1983 2061 1.01e1 SMART
FN1 2085 2129 3.72e-19 SMART
FN1 2130 2172 2.49e-20 SMART
FN1 2174 2214 2.69e-16 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188894
AA Change: V2045D

PolyPhen 2 Score 0.791 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140471
Gene: ENSMUSG00000026193
AA Change: V2045D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2057 2074 N/A INTRINSIC
FN3 2102 2181 2.9e0 SMART
FN1 2205 2249 3.72e-19 SMART
FN1 2250 2292 2.49e-20 SMART
FN1 2294 2334 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189821
SMART Domains Protein: ENSMUSP00000139702
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1891 6.79e-13 SMART
FN3 1893 1971 1.01e1 SMART
FN1 1995 2039 3.72e-19 SMART
FN1 2040 2082 2.49e-20 SMART
FN1 2084 2124 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190780
AA Change: V1930D

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140816
Gene: ENSMUSG00000026193
AA Change: V1930D

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1942 1959 N/A INTRINSIC
FN3 1987 2066 2.9e0 SMART
FN1 2090 2134 3.72e-19 SMART
FN1 2135 2177 2.49e-20 SMART
FN1 2179 2219 2.69e-16 SMART
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants are defective in mesodermal function. Null mutants are embryonic lethal with major patterning and organizational defects. Conditional mutants live and show increased neuronal apoptosis and susceptibility to induced cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Acta2 T C 19: 34,248,534 I87V probably benign Het
Arid1a A G 4: 133,685,204 Y1560H unknown Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Mtbp C T 15: 55,603,201 P537S probably benign Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Parp1 C T 1: 180,600,440 probably benign Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Plxnd1 T C 6: 115,994,001 I269V possibly damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Tulp2 T G 7: 45,519,786 I259S probably damaging Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Fn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fn1 APN 1 71652873 missense probably benign 0.28
IGL00402:Fn1 APN 1 71641163 missense probably damaging 1.00
IGL00946:Fn1 APN 1 71645540 splice site probably benign
IGL01311:Fn1 APN 1 71628140 missense probably damaging 1.00
IGL01338:Fn1 APN 1 71626210 missense probably damaging 0.98
IGL01353:Fn1 APN 1 71586939 missense probably damaging 1.00
IGL01674:Fn1 APN 1 71606741 missense probably damaging 1.00
IGL01701:Fn1 APN 1 71629853 splice site probably benign
IGL01734:Fn1 APN 1 71619485 missense probably damaging 1.00
IGL01788:Fn1 APN 1 71613837 missense probably damaging 1.00
IGL02186:Fn1 APN 1 71638534 missense probably damaging 1.00
IGL02398:Fn1 APN 1 71618670 splice site probably null
IGL02425:Fn1 APN 1 71641143 splice site probably benign
IGL02516:Fn1 APN 1 71637323 missense possibly damaging 0.78
IGL02593:Fn1 APN 1 71602432 missense probably benign
IGL02651:Fn1 APN 1 71597676 missense possibly damaging 0.65
IGL02681:Fn1 APN 1 71619482 missense probably damaging 1.00
IGL02890:Fn1 APN 1 71598372 critical splice donor site probably null
IGL02929:Fn1 APN 1 71595662 critical splice donor site probably null
IGL03036:Fn1 APN 1 71629773 missense probably damaging 1.00
IGL03088:Fn1 APN 1 71614038 splice site probably null
IGL03142:Fn1 APN 1 71637296 missense probably damaging 1.00
IGL03172:Fn1 APN 1 71641262 missense probably damaging 0.99
IGL03184:Fn1 APN 1 71609497 missense probably benign 0.02
IGL03212:Fn1 APN 1 71641325 nonsense probably null
IGL03246:Fn1 APN 1 71624296 missense possibly damaging 0.89
IGL03367:Fn1 APN 1 71597553 missense probably benign 0.27
PIT4514001:Fn1 UTSW 1 71628456 missense probably benign 0.01
R0008:Fn1 UTSW 1 71595720 missense probably damaging 0.98
R0112:Fn1 UTSW 1 71609653 missense probably damaging 1.00
R0138:Fn1 UTSW 1 71624110 missense possibly damaging 0.82
R0383:Fn1 UTSW 1 71597685 missense probably damaging 0.99
R0386:Fn1 UTSW 1 71595786 missense probably damaging 1.00
R0684:Fn1 UTSW 1 71595809 splice site probably null
R1054:Fn1 UTSW 1 71586214 makesense probably null
R1183:Fn1 UTSW 1 71586245 missense probably damaging 0.98
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1414:Fn1 UTSW 1 71601303 splice site probably benign
R1677:Fn1 UTSW 1 71597655 missense probably benign 0.00
R1773:Fn1 UTSW 1 71637383 missense probably damaging 1.00
R1830:Fn1 UTSW 1 71624259 missense probably damaging 1.00
R1987:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R1989:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R2068:Fn1 UTSW 1 71600439 missense probably damaging 1.00
R2113:Fn1 UTSW 1 71626164 missense probably damaging 1.00
R2145:Fn1 UTSW 1 71606004 missense probably damaging 1.00
R2246:Fn1 UTSW 1 71628535 missense probably benign 0.10
R2273:Fn1 UTSW 1 71613943 missense probably null 1.00
R2274:Fn1 UTSW 1 71613943 missense probably null 1.00
R2275:Fn1 UTSW 1 71613943 missense probably null 1.00
R2303:Fn1 UTSW 1 71614036 critical splice acceptor site probably null
R2379:Fn1 UTSW 1 71649284 nonsense probably null
R2382:Fn1 UTSW 1 71648119 missense probably damaging 1.00
R2567:Fn1 UTSW 1 71597736 nonsense probably null
R2864:Fn1 UTSW 1 71602419 missense probably damaging 0.99
R3154:Fn1 UTSW 1 71593083 missense probably damaging 1.00
R3837:Fn1 UTSW 1 71653155 utr 5 prime probably null
R3844:Fn1 UTSW 1 71609574 missense possibly damaging 0.61
R3886:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3887:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3888:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3889:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3905:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3906:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3907:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3909:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R4611:Fn1 UTSW 1 71624178 nonsense probably null
R4724:Fn1 UTSW 1 71648148 critical splice acceptor site probably null
R4732:Fn1 UTSW 1 71602512 splice site probably null
R4733:Fn1 UTSW 1 71602512 splice site probably null
R4756:Fn1 UTSW 1 71590808 missense probably damaging 1.00
R4809:Fn1 UTSW 1 71652800 intron probably benign
R4839:Fn1 UTSW 1 71642083 missense probably damaging 1.00
R4915:Fn1 UTSW 1 71595809 splice site probably null
R4917:Fn1 UTSW 1 71595809 splice site probably null
R4918:Fn1 UTSW 1 71595809 splice site probably null
R5002:Fn1 UTSW 1 71629728 missense possibly damaging 0.48
R5015:Fn1 UTSW 1 71626177 missense probably damaging 0.98
R5022:Fn1 UTSW 1 71624179 missense probably damaging 1.00
R5109:Fn1 UTSW 1 71649235 missense probably damaging 1.00
R5267:Fn1 UTSW 1 71629704 missense probably damaging 1.00
R5323:Fn1 UTSW 1 71597432 missense probably benign 0.09
R5333:Fn1 UTSW 1 71624180 missense probably damaging 1.00
R5631:Fn1 UTSW 1 71590196 missense probably damaging 1.00
R5644:Fn1 UTSW 1 71627250 missense probably damaging 1.00
R5754:Fn1 UTSW 1 71600322 missense probably damaging 1.00
R5807:Fn1 UTSW 1 71648059 missense probably damaging 1.00
R6053:Fn1 UTSW 1 71599290 missense probably damaging 1.00
R6133:Fn1 UTSW 1 71597727 missense probably damaging 1.00
R6186:Fn1 UTSW 1 71637290 missense probably damaging 1.00
R6270:Fn1 UTSW 1 71637275 missense probably damaging 1.00
R6332:Fn1 UTSW 1 71628071 missense probably benign 0.01
R6431:Fn1 UTSW 1 71647844 intron probably null
R6571:Fn1 UTSW 1 71626190 missense probably damaging 1.00
R6596:Fn1 UTSW 1 71609482 missense probably damaging 1.00
R6862:Fn1 UTSW 1 71613907 missense probably benign 0.43
R6898:Fn1 UTSW 1 71600413 missense probably damaging 1.00
R6984:Fn1 UTSW 1 71626079 missense probably damaging 1.00
R7107:Fn1 UTSW 1 71627249 missense probably damaging 1.00
R7127:Fn1 UTSW 1 71597544 missense probably benign 0.16
R7194:Fn1 UTSW 1 71602323 missense probably damaging 1.00
R7274:Fn1 UTSW 1 71628113 missense probably benign
R7285:Fn1 UTSW 1 71637339 missense probably damaging 1.00
X0023:Fn1 UTSW 1 71598373 critical splice donor site probably null
Z1088:Fn1 UTSW 1 71649292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCAGAACTCTCCTGGAACGGC -3'
(R):5'- CTTGGCTAGATGAGCTTCCCCAAC -3'

Sequencing Primer
(F):5'- TCTGAGAGAGAGCTTCCTGTCC -3'
(R):5'- ACTGGTTACCCTTCCACACC -3'
Posted On2013-07-11