Incidental Mutation 'R7386:Pfas'
ID573110
Institutional Source Beutler Lab
Gene Symbol Pfas
Ensembl Gene ENSMUSG00000020899
Gene Namephosphoribosylformylglycinamidine synthase (FGAR amidotransferase)
Synonyms4432409B16Rik, Sofa
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7386 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location68985697-69008460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 69003774 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 22 (V22L)
Ref Sequence ENSEMBL: ENSMUSP00000021282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021282]
Predicted Effect probably benign
Transcript: ENSMUST00000021282
AA Change: V22L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021282
Gene: ENSMUSG00000020899
AA Change: V22L

DomainStartEndE-ValueType
Pfam:AIRS_C 444 603 1.7e-21 PFAM
low complexity region 615 632 N/A INTRINSIC
low complexity region 786 798 N/A INTRINSIC
Pfam:AIRS_C 853 988 3e-11 PFAM
GATase_5 1061 1332 8.38e-133 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Purines are necessary for many cellular processes, including DNA replication, transcription, and energy metabolism. Ten enzymatic steps are required to synthesize inosine monophosphate (IMP) in the de novo pathway of purine biosynthesis. The enzyme encoded by this gene catalyzes the fourth step of IMP biosynthesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for spontaneous or ENU-induced mutations exhibit craniofacial abnormalities, most notably a domed cranium and short snout, variable white belly spots and white tail tips, and a range of eye defects including microphthalmia and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930546C10Rik A T 18: 68,950,137 M2K unknown Het
6430531B16Rik A T 7: 139,976,052 C225* probably null Het
Ablim3 T C 18: 61,821,994 D308G probably damaging Het
Adamts17 A T 7: 66,968,849 K370N probably benign Het
Adcy4 T C 14: 55,778,327 Y435C probably damaging Het
Adgb A T 10: 10,377,949 F1216I possibly damaging Het
Akr1a1 G A 4: 116,641,054 T98I probably damaging Het
Alyref2 G T 1: 171,503,533 probably benign Het
Ank3 T A 10: 69,822,249 H168Q unknown Het
Bnc1 A C 7: 81,974,492 L329R possibly damaging Het
Btaf1 G A 19: 36,958,382 A191T probably benign Het
Carmil3 T G 14: 55,497,747 probably null Het
Cd200r1 C A 16: 44,789,848 D143E probably benign Het
Cep112 A G 11: 108,808,681 H98R probably benign Het
Cmya5 T A 13: 93,069,323 Q3346L probably damaging Het
Cpne4 T A 9: 104,872,740 V81E possibly damaging Het
Ctnnd2 T A 15: 30,966,768 M955K probably damaging Het
Ctsj A T 13: 61,000,559 M307K possibly damaging Het
Ddhd2 G T 8: 25,754,290 R103S possibly damaging Het
Depdc5 A G 5: 32,927,936 T700A probably benign Het
Dhx57 A C 17: 80,267,577 D657E possibly damaging Het
Dmbt1 G A 7: 131,112,236 G1678S unknown Het
Dnajb1 A G 8: 83,610,303 D234G probably benign Het
Dsc2 C T 18: 20,041,926 V431M possibly damaging Het
Foxo3 T C 10: 42,197,360 D387G probably benign Het
Gda A G 19: 21,409,886 I325T probably benign Het
Gm960 G A 19: 4,663,558 R285* probably null Het
Iqgap1 A G 7: 80,726,042 S1362P probably damaging Het
Klf10 G T 15: 38,296,949 N282K possibly damaging Het
Mettl13 A G 1: 162,548,154 Y35H probably damaging Het
Mill2 A G 7: 18,858,290 T279A probably benign Het
Ncaph2 G A 15: 89,370,256 W386* probably null Het
Nploc4 A T 11: 120,408,881 S338T probably benign Het
Nrip1 T C 16: 76,293,887 S261G probably damaging Het
Olfr1042 A G 2: 86,159,530 V280A possibly damaging Het
Olfr1354 T A 10: 78,916,843 M1K probably null Het
Olfr1388 T C 11: 49,444,400 F183S possibly damaging Het
Palld A G 8: 61,532,052 F1060L unknown Het
Pygo2 T G 3: 89,432,821 F175L probably benign Het
Rnf2 T C 1: 151,471,380 E316G probably damaging Het
Rtn4 T A 11: 29,707,772 M642K probably damaging Het
Saa3 A G 7: 46,714,923 C60R unknown Het
Scap A G 9: 110,373,169 T202A probably benign Het
Scn9a T A 2: 66,540,550 D562V probably damaging Het
Slc6a19 A T 13: 73,689,891 V163E possibly damaging Het
Smc5 G A 19: 23,215,175 H850Y possibly damaging Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Sulf1 T C 1: 12,838,361 Y533H probably benign Het
Tex45 A G 8: 3,487,079 K475R probably benign Het
Thbs2 A G 17: 14,673,150 S923P possibly damaging Het
Themis A G 10: 28,789,747 D602G probably benign Het
Tmem132c A G 5: 127,563,926 K1054E probably benign Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tnrc6c T A 11: 117,721,954 C313S probably benign Het
Tpm1 T C 9: 67,028,167 I284M probably benign Het
Trpm4 A T 7: 45,314,640 L722H possibly damaging Het
Trub2 T G 2: 29,786,595 Q41P probably benign Het
Vgll1 TCCAGAGGTCTACCGTGTCTTTCCCGACAGGCATCTGACTCC TC X: 57,101,879 probably null Het
Zfp398 G A 6: 47,858,950 V148I probably benign Het
Zfp40 T C 17: 23,177,007 E202G probably damaging Het
Zfp618 T A 4: 63,095,385 probably null Het
Zfp667 T A 7: 6,305,950 I539N possibly damaging Het
Zfp738 A T 13: 67,670,250 C541S probably damaging Het
Other mutations in Pfas
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Pfas APN 11 69003814 nonsense probably null
IGL01287:Pfas APN 11 69001260 missense probably benign 0.09
IGL01712:Pfas APN 11 68991060 missense probably benign 0.34
IGL02019:Pfas APN 11 68993463 unclassified probably benign
IGL02053:Pfas APN 11 68992953 missense probably damaging 1.00
IGL02718:Pfas APN 11 69000145 splice site probably benign
IGL02801:Pfas APN 11 68988277 unclassified probably benign
Surf UTSW 11 68988021 missense probably damaging 1.00
PIT4812001:Pfas UTSW 11 68990036 missense
R0037:Pfas UTSW 11 69000036 missense probably damaging 1.00
R0046:Pfas UTSW 11 68990467 missense probably benign
R0046:Pfas UTSW 11 68990467 missense probably benign
R0408:Pfas UTSW 11 69001105 critical splice donor site probably null
R0532:Pfas UTSW 11 69002629 splice site probably benign
R0707:Pfas UTSW 11 68998037 missense probably benign 0.00
R0783:Pfas UTSW 11 69000521 missense probably damaging 1.00
R0946:Pfas UTSW 11 68993295 critical splice donor site probably null
R0946:Pfas UTSW 11 68990747 unclassified probably null
R1470:Pfas UTSW 11 68991359 missense probably benign
R1470:Pfas UTSW 11 68991359 missense probably benign
R1507:Pfas UTSW 11 68990034 missense probably benign 0.06
R1699:Pfas UTSW 11 68998046 critical splice acceptor site probably null
R1870:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1871:Pfas UTSW 11 68991969 missense probably damaging 1.00
R1959:Pfas UTSW 11 68994284 missense probably damaging 1.00
R2026:Pfas UTSW 11 68993957 missense probably damaging 1.00
R2180:Pfas UTSW 11 68992187 missense possibly damaging 0.92
R3808:Pfas UTSW 11 68989953 intron probably benign
R3809:Pfas UTSW 11 68989953 intron probably benign
R3872:Pfas UTSW 11 69000263 missense probably damaging 1.00
R3906:Pfas UTSW 11 68988286 unclassified probably benign
R4092:Pfas UTSW 11 68993949 missense probably benign
R4437:Pfas UTSW 11 68988417 missense probably damaging 1.00
R4599:Pfas UTSW 11 68991069 missense probably benign 0.15
R4763:Pfas UTSW 11 68990194 missense possibly damaging 0.81
R5116:Pfas UTSW 11 68990990 intron probably benign
R5310:Pfas UTSW 11 68988021 missense probably damaging 1.00
R5328:Pfas UTSW 11 68988592 missense probably damaging 1.00
R5351:Pfas UTSW 11 68991391 missense probably damaging 1.00
R5427:Pfas UTSW 11 69001153 missense possibly damaging 0.90
R5533:Pfas UTSW 11 68991470 missense probably benign 0.02
R5602:Pfas UTSW 11 68991045 missense probably benign 0.05
R5637:Pfas UTSW 11 68993323 missense probably damaging 1.00
R5645:Pfas UTSW 11 68991132 missense probably damaging 1.00
R6149:Pfas UTSW 11 68991945 missense probably benign 0.07
R6295:Pfas UTSW 11 68997999 missense probably benign 0.36
R6305:Pfas UTSW 11 69001197 missense possibly damaging 0.51
R6387:Pfas UTSW 11 69000465 missense probably damaging 1.00
R6425:Pfas UTSW 11 68991071 missense probably benign 0.17
R6523:Pfas UTSW 11 68990457 missense probably benign
R6914:Pfas UTSW 11 68992181 missense probably benign 0.01
R6915:Pfas UTSW 11 68992181 missense probably benign 0.01
R6945:Pfas UTSW 11 69000530 missense probably benign
R6957:Pfas UTSW 11 68993883 missense probably benign 0.14
R7025:Pfas UTSW 11 68990760 missense probably benign 0.01
R7257:Pfas UTSW 11 68992959 missense probably damaging 1.00
R7424:Pfas UTSW 11 69000092 missense probably damaging 1.00
R7459:Pfas UTSW 11 68988655 missense
Predicted Primers PCR Primer
(F):5'- TGCCTCAAGTTAAAAGCCAAACA -3'
(R):5'- ACCCACCTCTGTATCTCCAGTG -3'

Sequencing Primer
(F):5'- GGCTCAGGGGTTAATATCACCATC -3'
(R):5'- ATCTGCAGAAATGGCCC -3'
Posted On2019-09-13