Incidental Mutation 'R7387:Sec23ip'
ID573180
Institutional Source Beutler Lab
Gene Symbol Sec23ip
Ensembl Gene ENSMUSG00000055319
Gene NameSec23 interacting protein
SynonymsD7Ertd373e, p125
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R7387 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location128744943-128784836 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 128745003 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042942] [ENSMUST00000057557] [ENSMUST00000119081] [ENSMUST00000206986]
Predicted Effect probably benign
Transcript: ENSMUST00000042942
SMART Domains Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 41 51 N/A INTRINSIC
low complexity region 79 88 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 222 230 N/A INTRINSIC
Blast:DDHD 513 585 8e-33 BLAST
SAM 637 702 2.18e-9 SMART
DDHD 777 987 1.33e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057557
SMART Domains Protein: ENSMUSP00000062843
Gene: ENSMUSG00000048170

DomainStartEndE-ValueType
Pfam:MCM_bind 37 166 1.6e-44 PFAM
Pfam:Racemase_4 352 451 1.5e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119081
SMART Domains Protein: ENSMUSP00000113961
Gene: ENSMUSG00000048170

DomainStartEndE-ValueType
Pfam:MCM_bind 36 588 3.6e-210 PFAM
low complexity region 603 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205856
Predicted Effect probably benign
Transcript: ENSMUST00000206986
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522H14Rik A G 4: 109,505,577 Y182H probably damaging Het
Abca6 A G 11: 110,202,420 V1009A probably benign Het
Abcg2 A T 6: 58,689,624 I573F possibly damaging Het
Adck1 A G 12: 88,461,052 T480A probably benign Het
Adcy5 T C 16: 35,272,090 I607T probably damaging Het
Add2 A G 6: 86,086,015 K52E probably damaging Het
Arid4a T A 12: 71,087,496 S1191T probably damaging Het
Atg2a G T 19: 6,255,168 C1207F possibly damaging Het
Atg2b T C 12: 105,622,775 D1875G probably damaging Het
B3gntl1 A G 11: 121,629,915 L224P possibly damaging Het
BC035947 A G 1: 78,498,461 V478A possibly damaging Het
Cachd1 T C 4: 100,777,178 V17A unknown Het
Cad T C 5: 31,061,940 Y669H probably damaging Het
Ccdc110 A T 8: 45,942,196 M375L probably benign Het
Cdc6 C T 11: 98,908,216 probably benign Het
Cdhr4 T A 9: 107,996,912 Y72* probably null Het
Cenpe T G 3: 135,247,037 M1496R probably benign Het
Clec4a1 T G 6: 122,922,057 C28W possibly damaging Het
Cma2 A G 14: 55,973,048 N120S probably benign Het
Cped1 A T 6: 22,059,934 I200L probably benign Het
Cpsf1 A T 15: 76,602,566 S257T possibly damaging Het
Dnah6 G A 6: 73,212,612 Q18* probably null Het
Dpp10 T C 1: 123,341,140 E720G probably benign Het
Dus2 G A 8: 106,045,987 R243Q probably damaging Het
Dync2h1 T C 9: 7,157,932 N769S possibly damaging Het
Ece1 T A 4: 137,938,784 I313N possibly damaging Het
Ern1 A T 11: 106,421,952 V201E probably damaging Het
Exoc3l A G 8: 105,294,973 L141P probably damaging Het
Fam168b G A 1: 34,819,708 T131M probably damaging Het
Fam212a C T 9: 107,984,427 R230H probably damaging Het
Fez1 T C 9: 36,867,812 F262L probably damaging Het
H2-DMa T C 17: 34,138,127 Y200H probably damaging Het
H2-Eb1 T A 17: 34,314,233 V143D probably damaging Het
Ighv1-39 G A 12: 114,914,868 P28S probably benign Het
Iqgap1 C T 7: 80,720,990 V1544I probably benign Het
Itga10 A T 3: 96,652,778 Q536L probably benign Het
Itih2 C T 2: 10,130,508 E24K possibly damaging Het
Itsn2 A T 12: 4,639,781 N618I probably damaging Het
Kcnd2 T A 6: 21,216,778 S160R probably benign Het
Kif11 T A 19: 37,409,756 F677I probably damaging Het
Ldlrad2 C T 4: 137,574,517 C18Y probably damaging Het
Lrp4 T C 2: 91,476,614 V360A probably benign Het
Lrrtm2 T C 18: 35,212,972 T426A probably damaging Het
Mcidas T C 13: 112,994,088 F40L probably benign Het
Med27 T A 2: 29,413,407 L123Q possibly damaging Het
Mettl2 T C 11: 105,132,538 V249A probably benign Het
Mllt6 C A 11: 97,674,600 A592D probably benign Het
Mrps5 C T 2: 127,600,884 T291I probably damaging Het
Muc16 T A 9: 18,641,720 T4426S probably benign Het
Myh1 A T 11: 67,208,889 M542L probably benign Het
Nlrp12 G T 7: 3,241,201 A227D probably damaging Het
Nlrp14 T C 7: 107,183,107 Y504H probably damaging Het
Nr1i2 T C 16: 38,266,080 S8G probably benign Het
Ntrk2 A G 13: 58,985,979 K524R probably damaging Het
Nup210 C T 6: 91,021,396 probably null Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr1186 T A 2: 88,526,400 Y272* probably null Het
Olfr197 A T 16: 59,186,336 I49N probably damaging Het
Olfr677 T A 7: 105,057,090 Y281* probably null Het
Patl1 A G 19: 11,933,730 I525M probably benign Het
Pcnx3 A G 19: 5,673,336 L1277P probably benign Het
Pelp1 G A 11: 70,396,599 T461I probably damaging Het
Phf20 T C 2: 156,294,240 C660R probably damaging Het
Pkd1l1 T A 11: 8,901,203 Y1193F Het
Pknox2 G T 9: 36,957,068 probably benign Het
Pml T C 9: 58,229,894 T541A probably benign Het
Prss35 C T 9: 86,755,921 T248I probably damaging Het
Rccd1 T A 7: 80,320,602 N89I probably benign Het
Rcor3 T C 1: 192,137,524 probably benign Het
Rreb1 A G 13: 37,947,064 E16G unknown Het
Scgb2b12 T A 7: 32,326,635 H44L probably benign Het
Sgsm1 A C 5: 113,263,700 F720C probably damaging Het
Slc25a51 A T 4: 45,399,841 F116L possibly damaging Het
Spats2l T C 1: 57,902,134 V253A probably damaging Het
Spopl A T 2: 23,537,509 F204I probably benign Het
Sqle G A 15: 59,330,754 R519Q probably benign Het
Stil T G 4: 115,024,036 H592Q probably benign Het
Strip1 T A 3: 107,625,730 S201C probably damaging Het
Tcp11l1 C A 2: 104,699,930 A70S possibly damaging Het
Tmem163 T C 1: 127,519,443 probably null Het
Tmem184c A T 8: 77,597,930 Y310* probably null Het
Tmem30c T C 16: 57,270,023 N274D probably benign Het
Trim30c T A 7: 104,390,190 I133F probably damaging Het
Vars C T 17: 35,004,792 Q228* probably null Het
Zdbf2 G A 1: 63,304,039 V526I possibly damaging Het
Zfp819 T G 7: 43,612,641 probably null Het
Other mutations in Sec23ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Sec23ip APN 7 128767609 missense probably damaging 1.00
IGL01347:Sec23ip APN 7 128762405 missense probably benign 0.08
IGL01358:Sec23ip APN 7 128752797 missense possibly damaging 0.68
IGL01656:Sec23ip APN 7 128750245 missense probably damaging 1.00
IGL01835:Sec23ip APN 7 128755311 splice site probably null
IGL02233:Sec23ip APN 7 128779179 missense probably damaging 1.00
IGL02499:Sec23ip APN 7 128776916 missense probably damaging 1.00
IGL03381:Sec23ip APN 7 128750305 missense probably damaging 0.97
R0053:Sec23ip UTSW 7 128745167 missense probably damaging 1.00
R0147:Sec23ip UTSW 7 128779051 splice site probably benign
R0360:Sec23ip UTSW 7 128761405 splice site probably benign
R1427:Sec23ip UTSW 7 128776885 missense probably damaging 0.99
R1442:Sec23ip UTSW 7 128776786 missense probably benign 0.10
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1564:Sec23ip UTSW 7 128766281 splice site probably null
R1876:Sec23ip UTSW 7 128752851 missense probably benign
R1966:Sec23ip UTSW 7 128755353 missense probably damaging 0.98
R1977:Sec23ip UTSW 7 128766273 missense probably damaging 1.00
R2115:Sec23ip UTSW 7 128762461 missense probably benign 0.00
R2847:Sec23ip UTSW 7 128754073 missense probably benign 0.00
R3958:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3959:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3960:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R4287:Sec23ip UTSW 7 128777333 missense probably benign 0.37
R4510:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4511:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4612:Sec23ip UTSW 7 128750502 nonsense probably null
R4660:Sec23ip UTSW 7 128750286 missense probably null 0.00
R4890:Sec23ip UTSW 7 128752910 missense probably damaging 0.98
R5287:Sec23ip UTSW 7 128766136 missense probably benign
R5587:Sec23ip UTSW 7 128750427 missense probably benign
R5625:Sec23ip UTSW 7 128744983 unclassified probably benign
R5656:Sec23ip UTSW 7 128776784 missense probably damaging 1.00
R5808:Sec23ip UTSW 7 128772184 missense probably benign 0.00
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6145:Sec23ip UTSW 7 128778484 missense probably damaging 0.99
R6747:Sec23ip UTSW 7 128752849 synonymous silent
R6953:Sec23ip UTSW 7 128752796 nonsense probably null
R6992:Sec23ip UTSW 7 128765440 missense probably benign
R7131:Sec23ip UTSW 7 128779640 missense probably damaging 1.00
R7163:Sec23ip UTSW 7 128762533 critical splice donor site probably null
R7559:Sec23ip UTSW 7 128777350 missense not run
Predicted Primers PCR Primer
(F):5'- TCTATGCTGTGATTCCAGAGGC -3'
(R):5'- TCACTACCTCCGGGTAAGAG -3'

Sequencing Primer
(F):5'- TGTGATTCCAGAGGCTGACC -3'
(R):5'- TACCTCCGGGTAAGAGCAGGG -3'
Posted On2019-09-13