Incidental Mutation 'R7388:Olfr30'
ID573265
Institutional Source Beutler Lab
Gene Symbol Olfr30
Ensembl Gene ENSMUSG00000043314
Gene Nameolfactory receptor 30
SynonymsMTPCR07, MOR281-1, GA_x6K02T2NKPP-957001-957948
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R7388 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location58454105-58462270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58455655 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 98 (C98Y)
Ref Sequence ENSEMBL: ENSMUSP00000148907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055204] [ENSMUST00000064614] [ENSMUST00000215691]
Predicted Effect probably damaging
Transcript: ENSMUST00000055204
AA Change: C98Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055961
Gene: ENSMUSG00000043314
AA Change: C98Y

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 252 1.7e-6 PFAM
Pfam:7tm_1 42 291 8.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064614
SMART Domains Protein: ENSMUSP00000063665
Gene: ENSMUSG00000052642

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UPAR_LY6 47 124 1.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215691
AA Change: C98Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T C 3: 108,543,499 F86L possibly damaging Het
Afg3l2 T C 18: 67,422,953 E436G probably damaging Het
Agbl5 T A 5: 30,903,239 L759* probably null Het
Ankrd13b T C 11: 77,472,757 D460G probably benign Het
Apol10a A G 15: 77,489,025 D287G possibly damaging Het
Arhgap44 A T 11: 65,024,268 Y391* probably null Het
Asz1 G T 6: 18,074,901 S271R probably benign Het
AW554918 A G 18: 25,340,113 N325D probably benign Het
Brinp2 A T 1: 158,255,009 L247Q probably damaging Het
Casz1 A G 4: 148,952,393 D1704G unknown Het
Cdk5rap1 G A 2: 154,360,675 R212W probably damaging Het
Cdkl2 T A 5: 92,019,459 T444S probably benign Het
Cers2 T G 3: 95,321,345 F160V probably benign Het
Cga T A 4: 34,907,076 M99K probably benign Het
Cspp1 C T 1: 10,065,347 R138* probably null Het
Dao T G 5: 114,015,212 *133E probably null Het
Ddx1 A T 12: 13,225,455 C544S probably null Het
Dgkq A T 5: 108,658,246 V98E probably damaging Het
Dnah6 T A 6: 73,192,317 T434S possibly damaging Het
Dntt A G 19: 41,038,979 N162D probably benign Het
Dpysl5 T C 5: 30,745,461 V79A probably benign Het
E130309D02Rik G A 5: 143,311,845 A149V probably benign Het
Ep300 T C 15: 81,648,366 C1602R unknown Het
Fam159a G A 4: 108,367,822 T181I possibly damaging Het
Flrt3 C T 2: 140,661,752 probably null Het
Gk2 A G 5: 97,456,898 V27A probably damaging Het
Gm11639 T C 11: 104,721,045 L571P probably damaging Het
Gnpat T G 8: 124,887,814 M663R probably benign Het
Il12rb1 A G 8: 70,810,627 Y67C probably damaging Het
Kmt2b C T 7: 30,581,960 D1229N probably damaging Het
Lamc1 T C 1: 153,249,076 T650A probably damaging Het
Lrp1 G A 10: 127,583,897 R948* probably null Het
Map3k21 T C 8: 125,927,597 I385T probably damaging Het
Mmrn1 T A 6: 60,976,252 S506T probably benign Het
Nlrp1a A G 11: 71,123,197 F409S probably damaging Het
Nlrp3 T A 11: 59,565,066 I896N probably benign Het
Noxred1 C A 12: 87,227,025 V81L probably damaging Het
Nrcam A T 12: 44,598,489 I1225F probably damaging Het
Otos T A 1: 92,644,519 probably null Het
Pcdh20 A G 14: 88,468,667 I399T probably benign Het
Pkhd1 C T 1: 20,239,304 V2807I not run Het
Prrx2 A G 2: 30,880,890 E235G probably damaging Het
Rab13 T C 3: 90,221,020 I41T probably damaging Het
Rai1 A C 11: 60,189,375 T1422P possibly damaging Het
Rcn1 C T 2: 105,391,991 V217M probably damaging Het
Scn2a T A 2: 65,688,654 V408E probably damaging Het
Sec16a C T 2: 26,428,364 A121T Het
Slc35d1 A G 4: 103,189,785 probably null Het
Slc39a6 A T 18: 24,584,049 V642E probably damaging Het
Slc6a19 G A 13: 73,693,084 A69V probably benign Het
Spink6 A T 18: 44,082,319 T79S probably damaging Het
Spire1 T C 18: 67,519,880 D170G probably damaging Het
Sugp1 T C 8: 70,052,619 S79P probably damaging Het
Syne3 A G 12: 104,967,908 Y201H probably damaging Het
Tbc1d10a T C 11: 4,205,858 probably null Het
Tmem14a C T 1: 21,229,511 Q122* probably null Het
Tmem161b C A 13: 84,222,418 probably benign Het
Trmt61a A G 12: 111,678,887 I86V possibly damaging Het
Tubgcp4 G A 2: 121,189,966 probably null Het
Vmn1r79 T A 7: 12,176,741 Y183* probably null Het
Vmn2r11 A T 5: 109,054,876 W112R probably benign Het
Vpreb1 T C 16: 16,868,652 K125E probably benign Het
Wdr6 A T 9: 108,574,772 F637L probably damaging Het
Other mutations in Olfr30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Olfr30 APN 11 58455262 missense probably damaging 1.00
IGL02001:Olfr30 APN 11 58455509 missense probably benign 0.33
IGL02170:Olfr30 APN 11 58455080 missense probably damaging 1.00
IGL02638:Olfr30 APN 11 58455047 missense probably damaging 1.00
ANU22:Olfr30 UTSW 11 58455262 missense probably damaging 1.00
R0502:Olfr30 UTSW 11 58455314 missense possibly damaging 0.54
R0784:Olfr30 UTSW 11 58455305 missense possibly damaging 0.63
R1300:Olfr30 UTSW 11 58455841 missense probably damaging 1.00
R1451:Olfr30 UTSW 11 58455532 missense probably benign 0.00
R1642:Olfr30 UTSW 11 58455838 missense probably benign
R1754:Olfr30 UTSW 11 58455262 missense probably damaging 1.00
R1854:Olfr30 UTSW 11 58455431 missense probably damaging 1.00
R2920:Olfr30 UTSW 11 58455577 missense probably damaging 1.00
R3160:Olfr30 UTSW 11 58455227 missense probably damaging 1.00
R3162:Olfr30 UTSW 11 58455227 missense probably damaging 1.00
R4791:Olfr30 UTSW 11 58455544 missense possibly damaging 0.83
R4964:Olfr30 UTSW 11 58455907 missense probably benign 0.05
R5433:Olfr30 UTSW 11 58455854 missense probably damaging 0.99
R5543:Olfr30 UTSW 11 58455167 missense probably damaging 1.00
R6649:Olfr30 UTSW 11 58455568 missense probably damaging 0.98
R6653:Olfr30 UTSW 11 58455568 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCTGAATGGAGGCGTTG -3'
(R):5'- CCTGTTCCTGTTCAGCATGG -3'

Sequencing Primer
(F):5'- TGGAGGCGTTGAGGGACC -3'
(R):5'- GGTCTACATCCTTGCTATGGC -3'
Posted On2019-09-13