Incidental Mutation 'R0648:Arid1a'
ID57331
Institutional Source Beutler Lab
Gene Symbol Arid1a
Ensembl Gene ENSMUSG00000007880
Gene NameAT rich interactive domain 1A (SWI-like)
Synonyms1110030E03Rik, Smarcf1, BAF250a, Osa1
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0648 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133679008-133756769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133685204 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1560 (Y1560H)
Ref Sequence ENSEMBL: ENSMUSP00000122354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008024] [ENSMUST00000105897] [ENSMUST00000145664]
Predicted Effect unknown
Transcript: ENSMUST00000008024
AA Change: Y1175H
SMART Domains Protein: ENSMUSP00000008024
Gene: ENSMUSG00000007880
AA Change: Y1175H

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
low complexity region 86 110 N/A INTRINSIC
low complexity region 113 211 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
low complexity region 274 290 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
internal_repeat_3 329 402 4.13e-5 PROSPERO
low complexity region 410 426 N/A INTRINSIC
low complexity region 429 442 N/A INTRINSIC
internal_repeat_1 443 563 4.59e-6 PROSPERO
internal_repeat_2 461 595 1.38e-5 PROSPERO
low complexity region 604 626 N/A INTRINSIC
ARID 630 720 3.56e-25 SMART
BRIGHT 634 725 3.76e-31 SMART
low complexity region 739 751 N/A INTRINSIC
low complexity region 756 770 N/A INTRINSIC
internal_repeat_3 778 872 4.13e-5 PROSPERO
internal_repeat_2 781 928 1.38e-5 PROSPERO
internal_repeat_1 825 940 4.59e-6 PROSPERO
low complexity region 962 987 N/A INTRINSIC
low complexity region 1014 1045 N/A INTRINSIC
low complexity region 1187 1200 N/A INTRINSIC
low complexity region 1380 1404 N/A INTRINSIC
low complexity region 1500 1518 N/A INTRINSIC
Pfam:DUF3518 1592 1848 1.8e-146 PFAM
low complexity region 1849 1859 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000105897
AA Change: Y1556H
SMART Domains Protein: ENSMUSP00000101517
Gene: ENSMUSG00000007880
AA Change: Y1556H

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_2 828 948 9.26e-7 PROSPERO
internal_repeat_1 831 980 9.26e-7 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_1 1159 1314 9.26e-7 PROSPERO
internal_repeat_2 1211 1326 9.26e-7 PROSPERO
low complexity region 1343 1368 N/A INTRINSIC
low complexity region 1395 1426 N/A INTRINSIC
low complexity region 1568 1581 N/A INTRINSIC
low complexity region 1761 1785 N/A INTRINSIC
low complexity region 1881 1899 N/A INTRINSIC
Pfam:DUF3518 1973 2229 1.4e-146 PFAM
low complexity region 2230 2240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138473
Predicted Effect unknown
Transcript: ENSMUST00000145664
AA Change: Y1560H
SMART Domains Protein: ENSMUSP00000122354
Gene: ENSMUSG00000007880
AA Change: Y1560H

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 24 52 N/A INTRINSIC
low complexity region 74 96 N/A INTRINSIC
low complexity region 118 148 N/A INTRINSIC
low complexity region 161 169 N/A INTRINSIC
low complexity region 233 266 N/A INTRINSIC
low complexity region 273 295 N/A INTRINSIC
low complexity region 308 332 N/A INTRINSIC
low complexity region 367 373 N/A INTRINSIC
low complexity region 402 427 N/A INTRINSIC
low complexity region 471 495 N/A INTRINSIC
low complexity region 498 596 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 659 675 N/A INTRINSIC
low complexity region 695 708 N/A INTRINSIC
internal_repeat_3 714 787 9.49e-6 PROSPERO
low complexity region 795 811 N/A INTRINSIC
low complexity region 814 827 N/A INTRINSIC
internal_repeat_1 828 948 8.73e-7 PROSPERO
internal_repeat_2 846 980 2.88e-6 PROSPERO
low complexity region 989 1011 N/A INTRINSIC
ARID 1015 1105 3.56e-25 SMART
BRIGHT 1019 1110 3.76e-31 SMART
low complexity region 1124 1136 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
internal_repeat_3 1163 1257 9.49e-6 PROSPERO
internal_repeat_2 1166 1313 2.88e-6 PROSPERO
internal_repeat_1 1210 1325 8.73e-7 PROSPERO
low complexity region 1347 1372 N/A INTRINSIC
low complexity region 1399 1430 N/A INTRINSIC
low complexity region 1572 1585 N/A INTRINSIC
low complexity region 1765 1789 N/A INTRINSIC
low complexity region 1885 1903 N/A INTRINSIC
Pfam:DUF3518 1978 2233 1.3e-117 PFAM
low complexity region 2234 2244 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SWI/SNF family, whose members have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. It possesses at least two conserved domains that could be important for its function. First, it has a DNA-binding domain that can specifically bind an AT-rich DNA sequence known to be recognized by a SNF/SWI complex at the beta-globin locus. Second, the C-terminus of the protein can stimulate glucocorticoid receptor-dependent transcriptional activation. It is thought that the protein encoded by this gene confers specificity to the SNF/SWI complex and may recruit the complex to its targets through either protein-DNA or protein-protein interactions. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos with homozygous null alleles arrest development at E6.5 with failure to form a mesoderm layer. Mice homozygous for an allele lacking exon 2 and 3 die shortly after birth and exhibit an increase in the hematopoietic stem cell population of the fetal liver at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Acta2 T C 19: 34,248,534 I87V probably benign Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Fn1 A T 1: 71,597,585 V2045D possibly damaging Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Mtbp C T 15: 55,603,201 P537S probably benign Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Parp1 C T 1: 180,600,440 probably benign Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Plxnd1 T C 6: 115,994,001 I269V possibly damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Tulp2 T G 7: 45,519,786 I259S probably damaging Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Arid1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Arid1a APN 4 133685482 missense unknown
IGL01139:Arid1a APN 4 133693997 missense unknown
IGL01392:Arid1a APN 4 133681037 missense unknown
IGL01543:Arid1a APN 4 133681722 missense unknown
IGL01642:Arid1a APN 4 133681844 missense unknown
IGL01843:Arid1a APN 4 133681454 missense unknown
IGL02108:Arid1a APN 4 133680516 missense unknown
IGL02117:Arid1a APN 4 133692815 missense unknown
IGL02150:Arid1a APN 4 133687257 missense unknown
IGL02478:Arid1a APN 4 133681274 missense unknown
IGL02544:Arid1a APN 4 133681748 missense unknown
IGL03070:Arid1a APN 4 133694753 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0023:Arid1a UTSW 4 133691176 missense unknown
R0419:Arid1a UTSW 4 133681124 missense unknown
R0452:Arid1a UTSW 4 133689105 missense unknown
R0631:Arid1a UTSW 4 133689170 missense unknown
R1004:Arid1a UTSW 4 133687275 missense unknown
R1225:Arid1a UTSW 4 133687365 missense unknown
R1229:Arid1a UTSW 4 133691237 missense unknown
R1435:Arid1a UTSW 4 133680698 missense unknown
R1480:Arid1a UTSW 4 133680389 missense unknown
R1491:Arid1a UTSW 4 133720926 missense unknown
R1674:Arid1a UTSW 4 133689260 missense unknown
R1909:Arid1a UTSW 4 133693761 missense unknown
R1960:Arid1a UTSW 4 133753090 missense possibly damaging 0.84
R2018:Arid1a UTSW 4 133681834 missense unknown
R2147:Arid1a UTSW 4 133681366 missense unknown
R2303:Arid1a UTSW 4 133687251 missense unknown
R2320:Arid1a UTSW 4 133680529 missense unknown
R3775:Arid1a UTSW 4 133686764 missense unknown
R3907:Arid1a UTSW 4 133692912 splice site probably benign
R4509:Arid1a UTSW 4 133695699 intron probably benign
R4510:Arid1a UTSW 4 133695699 intron probably benign
R4551:Arid1a UTSW 4 133695699 intron probably benign
R4552:Arid1a UTSW 4 133695699 intron probably benign
R4606:Arid1a UTSW 4 133687323 missense unknown
R4745:Arid1a UTSW 4 133753106 missense probably benign 0.33
R4851:Arid1a UTSW 4 133681361 missense unknown
R4867:Arid1a UTSW 4 133720857 missense probably benign 0.01
R5203:Arid1a UTSW 4 133682003 missense unknown
R5227:Arid1a UTSW 4 133680405 missense unknown
R5294:Arid1a UTSW 4 133691055 splice site probably benign
R5299:Arid1a UTSW 4 133687226 missense unknown
R5412:Arid1a UTSW 4 133719602 unclassified probably benign
R5540:Arid1a UTSW 4 133680454 missense unknown
R5704:Arid1a UTSW 4 133681739 missense unknown
R5870:Arid1a UTSW 4 133681076 missense unknown
R6092:Arid1a UTSW 4 133693852 missense unknown
R6151:Arid1a UTSW 4 133684976 missense unknown
R6240:Arid1a UTSW 4 133680686 missense unknown
R6379:Arid1a UTSW 4 133680927 missense unknown
R6427:Arid1a UTSW 4 133681524 missense unknown
R6739:Arid1a UTSW 4 133687626 missense unknown
X0064:Arid1a UTSW 4 133689260 missense unknown
Predicted Primers PCR Primer
(F):5'- TCATCCCAGAGTGCAGGAATGGAG -3'
(R):5'- CAAATGATGGGTGGCCCCATACAG -3'

Sequencing Primer
(F):5'- GACTTGCTAGGAGAAGTACGGTTC -3'
(R):5'- TGGCCCCATACAGGCATC -3'
Posted On2013-07-11