Incidental Mutation 'R7389:Cyp2c50'
ID573334
Institutional Source Beutler Lab
Gene Symbol Cyp2c50
Ensembl Gene ENSMUSG00000054827
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 50
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7389 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location40089688-40113950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 40090663 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 150 (R150L)
Ref Sequence ENSEMBL: ENSMUSP00000079065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068094] [ENSMUST00000080171]
Predicted Effect probably benign
Transcript: ENSMUST00000068094
AA Change: R150L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000068039
Gene: ENSMUSG00000054827
AA Change: R150L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 225 3.7e-54 PFAM
Pfam:p450 213 428 6.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080171
AA Change: R150L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079065
Gene: ENSMUSG00000054827
AA Change: R150L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 1.2e-162 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Gm45618 A G 7: 142,120,351 S127P unknown Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Cyp2c50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01286:Cyp2c50 APN 19 40092284 missense probably benign 0.12
IGL01463:Cyp2c50 APN 19 40090978 missense probably damaging 1.00
IGL01669:Cyp2c50 APN 19 40098051 missense probably damaging 1.00
IGL02008:Cyp2c50 APN 19 40091099 nonsense probably null
IGL02331:Cyp2c50 APN 19 40090943 critical splice acceptor site probably null
IGL02830:Cyp2c50 APN 19 40098056 missense probably benign 0.00
R0115:Cyp2c50 UTSW 19 40092393 splice site probably benign
R1666:Cyp2c50 UTSW 19 40091055 missense probably benign
R1668:Cyp2c50 UTSW 19 40091055 missense probably benign
R1679:Cyp2c50 UTSW 19 40111415 missense possibly damaging 0.93
R2425:Cyp2c50 UTSW 19 40089848 missense probably benign 0.20
R2509:Cyp2c50 UTSW 19 40090569 missense probably benign
R2570:Cyp2c50 UTSW 19 40090320 missense probably benign 0.01
R3040:Cyp2c50 UTSW 19 40098126 missense probably benign 0.02
R3983:Cyp2c50 UTSW 19 40113518 missense possibly damaging 0.64
R4425:Cyp2c50 UTSW 19 40090692 missense possibly damaging 0.94
R4484:Cyp2c50 UTSW 19 40090639 missense probably damaging 1.00
R4520:Cyp2c50 UTSW 19 40090689 missense probably benign 0.02
R4820:Cyp2c50 UTSW 19 40113580 missense probably damaging 1.00
R4978:Cyp2c50 UTSW 19 40098057 missense probably damaging 1.00
R5335:Cyp2c50 UTSW 19 40090616 missense probably benign 0.00
R5807:Cyp2c50 UTSW 19 40113500 missense probably damaging 1.00
R5955:Cyp2c50 UTSW 19 40090943 critical splice acceptor site probably null
R6553:Cyp2c50 UTSW 19 40090602 missense probably benign 0.41
R6560:Cyp2c50 UTSW 19 40096855 missense probably benign 0.03
R7241:Cyp2c50 UTSW 19 40090568 missense probably benign
Z1088:Cyp2c50 UTSW 19 40097955 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TTCTATGGCAGCCACCAGAC -3'
(R):5'- GCCCTTGTTATCATGTTAAGACAC -3'

Sequencing Primer
(F):5'- AGACATCCTCTACTTCTACTCCAGG -3'
(R):5'- TTATGCTACATTTATGCTAAGGGC -3'
Posted On2019-09-13