Incidental Mutation 'R0648:Tulp2'
ID57344
Institutional Source Beutler Lab
Gene Symbol Tulp2
Ensembl Gene ENSMUSG00000023467
Gene Nametubby-like protein 2
Synonyms
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0648 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45481877-45523632 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 45519786 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 259 (I259S)
Ref Sequence ENSEMBL: ENSMUSP00000147710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024233] [ENSMUST00000042105] [ENSMUST00000085331] [ENSMUST00000107758] [ENSMUST00000107759] [ENSMUST00000107762] [ENSMUST00000167273] [ENSMUST00000209763] [ENSMUST00000210299] [ENSMUST00000210532] [ENSMUST00000210813] [ENSMUST00000210868] [ENSMUST00000211212]
Predicted Effect probably damaging
Transcript: ENSMUST00000024233
AA Change: I371S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024233
Gene: ENSMUSG00000023467
AA Change: I371S

DomainStartEndE-ValueType
low complexity region 67 77 N/A INTRINSIC
low complexity region 212 220 N/A INTRINSIC
Pfam:Tub 315 556 1.1e-116 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000042105
SMART Domains Protein: ENSMUSP00000049488
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 536 612 8.2e-15 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000085331
AA Change: I247S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082438
Gene: ENSMUSG00000023467
AA Change: I247S

DomainStartEndE-ValueType
low complexity region 88 96 N/A INTRINSIC
Pfam:Tub 191 432 6.2e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107758
AA Change: I266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103387
Gene: ENSMUSG00000023467
AA Change: I266S

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 451 4.1e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107759
AA Change: I259S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103388
Gene: ENSMUSG00000023467
AA Change: I259S

DomainStartEndE-ValueType
low complexity region 100 108 N/A INTRINSIC
Pfam:Tub 203 444 3.4e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107762
AA Change: I371S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103391
Gene: ENSMUSG00000023467
AA Change: I371S

DomainStartEndE-ValueType
Pfam:Tub_N 39 295 8.8e-36 PFAM
Pfam:Tub 315 556 1.3e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167273
SMART Domains Protein: ENSMUSP00000128497
Gene: ENSMUSG00000040435

DomainStartEndE-ValueType
low complexity region 149 160 N/A INTRINSIC
low complexity region 225 234 N/A INTRINSIC
internal_repeat_1 245 333 1.03e-15 PROSPERO
low complexity region 334 351 N/A INTRINSIC
internal_repeat_1 357 447 1.03e-15 PROSPERO
low complexity region 448 459 N/A INTRINSIC
low complexity region 520 530 N/A INTRINSIC
Pfam:PP1c_bdg 531 612 1.1e-20 PFAM
low complexity region 636 652 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209763
Predicted Effect probably benign
Transcript: ENSMUST00000210299
Predicted Effect probably benign
Transcript: ENSMUST00000210532
Predicted Effect probably damaging
Transcript: ENSMUST00000210813
AA Change: I266S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000210868
AA Change: I259S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211212
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211413
Meta Mutation Damage Score 0.236 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Acta2 T C 19: 34,248,534 I87V probably benign Het
Arid1a A G 4: 133,685,204 Y1560H unknown Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Fn1 A T 1: 71,597,585 V2045D possibly damaging Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Mtbp C T 15: 55,603,201 P537S probably benign Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Parp1 C T 1: 180,600,440 probably benign Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Plxnd1 T C 6: 115,994,001 I269V possibly damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Tulp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Tulp2 APN 7 45521908 missense probably damaging 1.00
IGL00942:Tulp2 APN 7 45516268 missense possibly damaging 0.87
IGL01881:Tulp2 APN 7 45520795 missense probably damaging 1.00
IGL03240:Tulp2 APN 7 45522310 missense probably damaging 1.00
IGL03242:Tulp2 APN 7 45521858 missense probably damaging 0.99
IGL03353:Tulp2 APN 7 45516272 missense probably damaging 1.00
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0063:Tulp2 UTSW 7 45520860 unclassified probably benign
R0306:Tulp2 UTSW 7 45518576 unclassified probably benign
R0710:Tulp2 UTSW 7 45520808 missense possibly damaging 0.92
R1168:Tulp2 UTSW 7 45517842 missense probably benign
R1345:Tulp2 UTSW 7 45518721 missense probably benign 0.13
R1737:Tulp2 UTSW 7 45519777 missense probably damaging 1.00
R1854:Tulp2 UTSW 7 45517943 missense probably damaging 0.98
R1918:Tulp2 UTSW 7 45517941 missense possibly damaging 0.95
R2356:Tulp2 UTSW 7 45518628 missense possibly damaging 0.85
R3012:Tulp2 UTSW 7 45518763 missense probably damaging 1.00
R3419:Tulp2 UTSW 7 45518752 missense possibly damaging 0.56
R4236:Tulp2 UTSW 7 45521874 missense probably damaging 1.00
R4701:Tulp2 UTSW 7 45517924 missense probably damaging 0.98
R5367:Tulp2 UTSW 7 45516651 missense possibly damaging 0.95
R6056:Tulp2 UTSW 7 45490373 unclassified probably null
R6294:Tulp2 UTSW 7 45514692 missense probably damaging 1.00
R6432:Tulp2 UTSW 7 45518588 missense probably benign 0.01
R6875:Tulp2 UTSW 7 45518614 missense probably benign 0.05
Z1088:Tulp2 UTSW 7 45521986 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGCCTTCCATTCACTGGCTAAG -3'
(R):5'- GCCCACGTTGACTCTCTAAGAACC -3'

Sequencing Primer
(F):5'- TTCACTGGCTAAGCCACAC -3'
(R):5'- AACTCATCAGGCTTTAGTGCCAG -3'
Posted On2013-07-11