Incidental Mutation 'R7391:Cyp2d34'
ID573464
Institutional Source Beutler Lab
Gene Symbol Cyp2d34
Ensembl Gene ENSMUSG00000094559
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 34
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7391 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82615965-82620946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82618386 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 183 (N183I)
Ref Sequence ENSEMBL: ENSMUSP00000105141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109515] [ENSMUST00000229833]
Predicted Effect probably benign
Transcript: ENSMUST00000109515
AA Change: N183I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105141
Gene: ENSMUSG00000094559
AA Change: N183I

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:p450 37 497 3.2e-141 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229833
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 A T 10: 18,646,259 I673K probably benign Het
Arhgap32 C A 9: 32,181,939 T196K probably benign Het
B3gnt2 A T 11: 22,836,482 C235* probably null Het
BC080695 T A 4: 143,572,306 L273H probably damaging Het
Capn5 C T 7: 98,131,219 V315M probably benign Het
Ccl24 T A 5: 135,570,822 R111S possibly damaging Het
Cdk9 A G 2: 32,712,071 V45A probably damaging Het
Cep162 G T 9: 87,248,494 S21* probably null Het
Chil3 T A 3: 106,164,180 Y56F probably damaging Het
Ctr9 T A 7: 111,043,171 L368* probably null Het
Ctss A G 3: 95,529,541 E45G probably benign Het
Cyp2c29 A T 19: 39,307,767 Q214L probably null Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Ermp1 C A 19: 29,627,068 probably null Het
Ermp1 T A 19: 29,627,069 probably null Het
Evi2 A G 11: 79,515,667 S361P probably benign Het
Ext2 T A 2: 93,730,267 K518M probably damaging Het
Fgl1 A C 8: 41,210,446 M15R probably benign Het
Fsip2 T G 2: 82,990,319 D5465E possibly damaging Het
Hdlbp A T 1: 93,431,061 I256N possibly damaging Het
Hnrnpu T C 1: 178,337,078 Q165R unknown Het
Homer3 G A 8: 70,289,484 A132T probably benign Het
Ikbkap T G 4: 56,781,212 Q487P probably benign Het
Ikbkap C A 4: 56,781,211 Q487H possibly damaging Het
Kcnb1 T C 2: 167,105,450 R493G probably damaging Het
Kcnn3 A T 3: 89,609,471 T396S probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krtap4-1 A G 11: 99,627,984 S67P unknown Het
Lama4 G T 10: 39,087,387 probably null Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Mical2 A T 7: 112,320,609 E442V probably damaging Het
Muc16 C T 9: 18,639,536 V5154I probably benign Het
Nav3 A T 10: 109,703,456 M2028K probably benign Het
Ncr1 T A 7: 4,344,471 W249R possibly damaging Het
Neurod6 T C 6: 55,679,631 D7G probably damaging Het
Nwd1 A G 8: 72,662,418 E158G probably damaging Het
Olfr132 A T 17: 38,131,050 F47L probably benign Het
Olfr1328 A T 4: 118,934,001 N282K possibly damaging Het
Olfr1381 T C 11: 49,552,544 S266P probably damaging Het
Olfr1395 A G 11: 49,148,979 T241A probably damaging Het
Olfr33 T C 7: 102,713,982 N144D probably benign Het
Padi2 A G 4: 140,937,955 D457G probably benign Het
Pcdh1 C T 18: 38,202,785 E266K possibly damaging Het
Pigr A G 1: 130,849,566 D703G probably damaging Het
Ppm1f T A 16: 16,914,234 S183T probably benign Het
Ppp2r5b T A 19: 6,228,514 Q455L probably benign Het
Ptpn13 C T 5: 103,540,981 S880L probably damaging Het
R3hdm4 T C 10: 79,911,109 K240R probably benign Het
Rin1 T C 19: 5,050,860 M1T probably null Het
Rundc3b T A 5: 8,559,455 M170L probably benign Het
Ryr3 A T 2: 112,780,977 probably null Het
Scn11a T C 9: 119,795,717 D513G probably damaging Het
Slc27a2 C A 2: 126,553,162 P3Q unknown Het
Slc4a8 A G 15: 100,784,862 I187M probably damaging Het
Slc6a11 A T 6: 114,238,461 I441F probably benign Het
Stx2 C T 5: 128,988,803 R263Q probably damaging Het
Svep1 A T 4: 58,145,185 W427R probably damaging Het
Tes T A 6: 17,096,167 H51Q probably damaging Het
Thnsl2 T C 6: 71,131,930 D299G probably damaging Het
Tmem30b T C 12: 73,545,928 S138G probably benign Het
Tmprss11c T A 5: 86,237,791 H274L probably damaging Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Ttc30a1 T C 2: 75,980,015 K575E probably benign Het
Unc13b A G 4: 43,216,459 I253V probably benign Het
Unc80 A G 1: 66,695,528 S3305G probably benign Het
Ush2a TCACC TC 1: 188,962,008 probably benign Het
Virma A G 4: 11,508,099 D267G probably damaging Het
Vmn1r46 C T 6: 89,976,625 S152L probably benign Het
Wdr90 T C 17: 25,846,528 N1621S probably benign Het
Zfhx3 G A 8: 108,947,843 A1842T probably damaging Het
Zfp583 A G 7: 6,316,499 S505P probably damaging Het
Zfp608 T C 18: 54,897,547 Y1107C possibly damaging Het
Zfp616 A G 11: 74,085,329 H808R probably benign Het
Zfp677 T C 17: 21,398,391 F570S possibly damaging Het
Zfp85 A T 13: 67,749,291 Y221N probably damaging Het
Other mutations in Cyp2d34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Cyp2d34 APN 15 82617535 missense probably damaging 0.96
IGL00914:Cyp2d34 APN 15 82620714 missense probably damaging 0.98
IGL01347:Cyp2d34 APN 15 82616777 missense possibly damaging 0.89
IGL01354:Cyp2d34 APN 15 82617622 missense probably benign 0.00
IGL01681:Cyp2d34 APN 15 82617131 critical splice donor site probably null
IGL01733:Cyp2d34 APN 15 82618660 missense possibly damaging 0.73
IGL02231:Cyp2d34 APN 15 82618606 missense probably benign 0.44
IGL02425:Cyp2d34 APN 15 82618279 missense probably benign
IGL03219:Cyp2d34 APN 15 82618539 missense probably benign 0.01
R0684:Cyp2d34 UTSW 15 82617550 missense probably benign 0.06
R0811:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R0812:Cyp2d34 UTSW 15 82618606 missense probably benign 0.44
R1617:Cyp2d34 UTSW 15 82620845 missense probably benign 0.21
R1756:Cyp2d34 UTSW 15 82617524 missense probably damaging 1.00
R1827:Cyp2d34 UTSW 15 82616094 missense probably benign 0.00
R1962:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R2102:Cyp2d34 UTSW 15 82616773 missense probably benign 0.17
R2113:Cyp2d34 UTSW 15 82617616 missense probably damaging 1.00
R2432:Cyp2d34 UTSW 15 82619011 missense probably damaging 1.00
R2566:Cyp2d34 UTSW 15 82616167 missense probably damaging 1.00
R3154:Cyp2d34 UTSW 15 82617566 missense probably benign 0.04
R3834:Cyp2d34 UTSW 15 82616746 critical splice donor site probably null
R3881:Cyp2d34 UTSW 15 82618617 missense probably benign 0.00
R4022:Cyp2d34 UTSW 15 82618608 missense probably benign 0.10
R4181:Cyp2d34 UTSW 15 82617285 splice site probably null
R4613:Cyp2d34 UTSW 15 82616325 missense probably damaging 0.98
R4636:Cyp2d34 UTSW 15 82620728 missense probably damaging 1.00
R4695:Cyp2d34 UTSW 15 82616891 missense probably benign
R4993:Cyp2d34 UTSW 15 82618329 missense probably damaging 1.00
R5262:Cyp2d34 UTSW 15 82618371 missense probably damaging 1.00
R5402:Cyp2d34 UTSW 15 82619086 missense probably damaging 1.00
R5772:Cyp2d34 UTSW 15 82617140 missense probably null 0.24
R5874:Cyp2d34 UTSW 15 82619042 missense probably benign 0.04
R6051:Cyp2d34 UTSW 15 82616770 missense probably damaging 1.00
R6057:Cyp2d34 UTSW 15 82616351 missense probably benign
R6143:Cyp2d34 UTSW 15 82620776 missense probably benign 0.25
R6452:Cyp2d34 UTSW 15 82616089 missense probably benign 0.00
R7296:Cyp2d34 UTSW 15 82617235 missense possibly damaging 0.87
R7398:Cyp2d34 UTSW 15 82616763 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGATGGATCACACAGCACTGG -3'
(R):5'- TGTATCCACCCTGCGAAACTTC -3'

Sequencing Primer
(F):5'- ACAGCACTGGCCCTATAGGTTG -3'
(R):5'- TTCGGCCTGGGCAAGAAATC -3'
Posted On2019-09-13