Incidental Mutation 'R7393:Scg2'
ID573566
Institutional Source Beutler Lab
Gene Symbol Scg2
Ensembl Gene ENSMUSG00000050711
Gene Namesecretogranin II
SynonymsSgII, Chgc
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7393 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location79434669-79440120 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79435231 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 552 (K552E)
Ref Sequence ENSEMBL: ENSMUSP00000139740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049972] [ENSMUST00000185234]
Predicted Effect probably damaging
Transcript: ENSMUST00000049972
AA Change: K592E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062556
Gene: ENSMUSG00000050711
AA Change: K592E

DomainStartEndE-ValueType
Pfam:Granin 27 614 7.2e-235 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000185234
AA Change: K552E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139740
Gene: ENSMUSG00000050711
AA Change: K552E

DomainStartEndE-ValueType
Pfam:Granin 27 319 1.4e-123 PFAM
Pfam:Granin 316 574 7.1e-91 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the chromogranin/secretogranin family of neuroendocrine secretory proteins. Studies in rodents suggest that the full-length protein, secretogranin II, is involved in the packaging or sorting of peptide hormones and neuropeptides into secretory vesicles. The full-length protein is cleaved to produce the active peptide secretoneurin, which exerts chemotaxic effects on specific cell types, and EM66, whose function is unknown. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010107E04Rik A G 12: 111,963,277 V26A probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Abi2 T C 1: 60,434,382 M86T possibly damaging Het
Adam26a T C 8: 43,569,688 N255S probably benign Het
Adam4 G A 12: 81,419,660 S729L probably benign Het
Adcy1 G T 11: 7,137,381 W418C probably damaging Het
Add2 T A 6: 86,098,647 Y259* probably null Het
Agl A T 3: 116,791,156 C172S probably benign Het
Ankfy1 A G 11: 72,738,308 T319A possibly damaging Het
Armc8 A T 9: 99,483,999 C621S possibly damaging Het
Bbc3 A G 7: 16,313,789 D146G probably benign Het
Btnl10 T C 11: 58,923,706 L404P probably damaging Het
Cbl A G 9: 44,154,188 probably null Het
Ccdc170 T A 10: 4,514,314 probably null Het
Ccdc91 T A 6: 147,534,029 V37E possibly damaging Het
Ces1e G T 8: 93,210,417 T343K probably benign Het
Chfr T A 5: 110,152,358 F323I probably damaging Het
Clcnkb T A 4: 141,409,445 M370L probably benign Het
Col11a1 A G 3: 114,097,106 D364G unknown Het
Ctbp2 A G 7: 132,988,292 I381T probably benign Het
Cyp4a29 A C 4: 115,242,196 Y38S probably damaging Het
Ddx1 T C 12: 13,230,353 D382G probably benign Het
Dhx57 T A 17: 80,255,571 N876Y probably damaging Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam234a T C 17: 26,216,624 D262G probably benign Het
Fnbp4 C A 2: 90,779,316 Q1035K probably damaging Het
Gbp11 T A 5: 105,327,577 N302Y possibly damaging Het
Gm11554 T A 11: 99,803,872 T172S unknown Het
Hamp2 A T 7: 30,922,605 M53K possibly damaging Het
Kcnj1 A G 9: 32,397,018 D246G probably damaging Het
Kctd20 T C 17: 28,963,338 F209L probably damaging Het
Klra2 T C 6: 131,230,202 Y148C probably damaging Het
Krtap15 T C 16: 88,829,097 probably null Het
Mrps23 T C 11: 88,204,458 L6P probably damaging Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Myo7a G A 7: 98,063,699 R1690C possibly damaging Het
Nbas T C 12: 13,393,492 S1183P probably damaging Het
Ndufaf4 T A 4: 24,903,177 M122K probably benign Het
Nop2 C A 6: 125,133,546 S45* probably null Het
Nop56 T A 2: 130,274,638 L3Q probably benign Het
Nrp2 T C 1: 62,745,424 I244T probably damaging Het
Olfr1426 T A 19: 12,088,628 T55S probably benign Het
Olfr620 A G 7: 103,611,991 S121P possibly damaging Het
Otof T C 5: 30,370,270 D1941G probably benign Het
Pcyox1l T C 18: 61,697,641 K387E probably benign Het
Plcg2 A G 8: 117,579,825 Y306C possibly damaging Het
Ppp1r13b G A 12: 111,838,754 P333S probably damaging Het
Rcc2 A G 4: 140,717,030 D344G probably damaging Het
Reln A T 5: 21,976,351 N1810K probably damaging Het
Rfesd G T 13: 76,003,030 A90E probably benign Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Sdccag8 A G 1: 176,840,306 I190V probably benign Het
Sele C A 1: 164,053,923 T533K probably benign Het
Sh3bp4 T A 1: 89,144,448 H339Q possibly damaging Het
Slc6a19 A G 13: 73,692,974 S106P probably benign Het
Spidr C T 16: 16,146,831 probably benign Het
Stk36 A T 1: 74,611,193 K295* probably null Het
Synj1 A T 16: 90,951,999 D1056E probably damaging Het
Tnks1bp1 T C 2: 85,062,866 S1046P probably benign Het
Ttc27 T G 17: 74,770,264 F385V possibly damaging Het
Ttn C A 2: 76,944,345 G2164W unknown Het
Ubap1 T A 4: 41,379,764 L326* probably null Het
Ubr4 A G 4: 139,426,785 N812S probably damaging Het
Vmn1r160 A G 7: 22,871,353 T44A possibly damaging Het
Vmn1r28 G A 6: 58,265,589 S139N possibly damaging Het
Vmn2r116 A G 17: 23,386,125 I137M probably benign Het
Vmn2r67 A T 7: 85,155,878 W9R probably null Het
Zfp101 T C 17: 33,386,700 N45D possibly damaging Het
Other mutations in Scg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Scg2 APN 1 79436821 missense probably benign 0.16
IGL02083:Scg2 APN 1 79436224 missense probably benign 0.00
IGL02316:Scg2 APN 1 79435681 missense probably damaging 1.00
IGL02338:Scg2 APN 1 79436493 missense possibly damaging 0.93
R0281:Scg2 UTSW 1 79435512 missense possibly damaging 0.95
R0384:Scg2 UTSW 1 79435549 missense probably benign 0.42
R0501:Scg2 UTSW 1 79435603 missense probably damaging 1.00
R0909:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R1773:Scg2 UTSW 1 79435635 missense probably benign 0.04
R2254:Scg2 UTSW 1 79436500 missense probably damaging 1.00
R4074:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4076:Scg2 UTSW 1 79436857 missense probably damaging 0.97
R4097:Scg2 UTSW 1 79435821 missense probably damaging 0.99
R4560:Scg2 UTSW 1 79435181 missense probably damaging 1.00
R4621:Scg2 UTSW 1 79436664 missense probably benign 0.08
R4876:Scg2 UTSW 1 79435919 missense probably damaging 1.00
R4944:Scg2 UTSW 1 79436476 nonsense probably null
R5829:Scg2 UTSW 1 79436920 missense probably damaging 1.00
R6158:Scg2 UTSW 1 79435400 missense probably damaging 1.00
R6248:Scg2 UTSW 1 79436306 missense probably benign 0.29
R6365:Scg2 UTSW 1 79435300 missense probably benign
R6459:Scg2 UTSW 1 79436290 missense probably damaging 1.00
R6676:Scg2 UTSW 1 79435782 missense possibly damaging 0.74
R6693:Scg2 UTSW 1 79436020 missense probably benign 0.01
R7259:Scg2 UTSW 1 79436985 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGTCATCTGCCTATACATCAC -3'
(R):5'- AACCAGCTGAAGAGAGTGCC -3'

Sequencing Primer
(F):5'- TCATCTGCCTATACATCACTTTAAAG -3'
(R):5'- AAGAGAGTGCCCAGTCCAGTC -3'
Posted On2019-09-13