Incidental Mutation 'R7394:Cfap57'
ID573647
Institutional Source Beutler Lab
Gene Symbol Cfap57
Ensembl Gene ENSMUSG00000028730
Gene Namecilia and flagella associated protein 57
SynonymsWdr65, 1110020C03Rik, C130004B06Rik, LOC384050
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7394 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118554551-118620777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118593137 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 596 (Y596F)
Ref Sequence ENSEMBL: ENSMUSP00000071863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071972] [ENSMUST00000081921]
Predicted Effect probably benign
Transcript: ENSMUST00000071972
AA Change: Y596F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000071863
Gene: ENSMUSG00000028730
AA Change: Y596F

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081921
AA Change: Y596F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000080592
Gene: ENSMUSG00000028730
AA Change: Y596F

DomainStartEndE-ValueType
Blast:WD40 44 88 3e-12 BLAST
Blast:WD40 95 137 1e-9 BLAST
WD40 140 181 1.77e2 SMART
internal_repeat_1 182 237 7.23e-5 PROSPERO
WD40 329 365 1.27e2 SMART
WD40 376 416 3.4e-2 SMART
WD40 418 456 1.59e1 SMART
Blast:WD40 461 497 4e-18 BLAST
WD40 500 539 9.67e-7 SMART
WD40 544 581 3.96e1 SMART
Blast:WD40 582 621 8e-16 BLAST
WD40 626 665 3.21e-1 SMART
coiled coil region 690 1056 N/A INTRINSIC
coiled coil region 1094 1166 N/A INTRINSIC
coiled coil region 1197 1222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein encoded by this gene belongs to the WD repeat-containing family of proteins, which function in the formation of protein-protein complexes in a variety of biological pathways. This family member is thought to function in craniofacial development, possibly in the fusion of lip and palate. A missense mutation in this gene is associated with Van der Woude syndrome 2. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Cfap57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Cfap57 APN 4 118581001 missense probably benign 0.01
IGL00508:Cfap57 APN 4 118581170 splice site probably null
IGL00857:Cfap57 APN 4 118612923 critical splice donor site probably null
IGL01147:Cfap57 APN 4 118589001 missense probably damaging 0.97
IGL01396:Cfap57 APN 4 118610595 missense probably damaging 1.00
IGL01420:Cfap57 APN 4 118612940 missense probably benign 0.21
IGL01615:Cfap57 APN 4 118600796 missense probably damaging 1.00
IGL02154:Cfap57 APN 4 118613017 missense probably damaging 1.00
IGL02161:Cfap57 APN 4 118579372 missense possibly damaging 0.75
IGL02481:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02483:Cfap57 APN 4 118581105 missense probably damaging 1.00
IGL02503:Cfap57 APN 4 118569348 critical splice donor site probably null
IGL02800:Cfap57 APN 4 118614750 missense probably damaging 1.00
IGL03083:Cfap57 APN 4 118584739 missense probably damaging 0.96
IGL03146:Cfap57 APN 4 118599019 missense probably damaging 1.00
IGL03246:Cfap57 APN 4 118576645 missense probably benign 0.29
IGL03376:Cfap57 APN 4 118584720 missense probably damaging 0.96
R0144:Cfap57 UTSW 4 118584705 missense probably damaging 1.00
R0184:Cfap57 UTSW 4 118599012 missense probably damaging 1.00
R0415:Cfap57 UTSW 4 118569431 missense possibly damaging 0.89
R0515:Cfap57 UTSW 4 118620402 missense probably damaging 1.00
R0690:Cfap57 UTSW 4 118569727 splice site probably benign
R0730:Cfap57 UTSW 4 118612920 splice site probably null
R0737:Cfap57 UTSW 4 118581102 missense possibly damaging 0.81
R0854:Cfap57 UTSW 4 118561872 missense probably benign 0.04
R0880:Cfap57 UTSW 4 118581838 nonsense probably null
R1085:Cfap57 UTSW 4 118595779 missense probably benign 0.20
R1119:Cfap57 UTSW 4 118606676 nonsense probably null
R1217:Cfap57 UTSW 4 118606652 missense possibly damaging 0.67
R1294:Cfap57 UTSW 4 118606534 critical splice donor site probably null
R1487:Cfap57 UTSW 4 118614781 missense probably benign 0.01
R1676:Cfap57 UTSW 4 118595940 missense probably damaging 1.00
R1688:Cfap57 UTSW 4 118569646 missense probably null 0.20
R1709:Cfap57 UTSW 4 118571704 missense probably benign 0.00
R1719:Cfap57 UTSW 4 118606631 missense probably benign 0.04
R1782:Cfap57 UTSW 4 118614975 missense probably damaging 0.98
R1791:Cfap57 UTSW 4 118571724 missense possibly damaging 0.66
R1850:Cfap57 UTSW 4 118599894 missense probably damaging 1.00
R1866:Cfap57 UTSW 4 118599927 missense possibly damaging 0.49
R1912:Cfap57 UTSW 4 118615010 missense probably damaging 0.96
R1978:Cfap57 UTSW 4 118593132 missense probably benign 0.03
R2177:Cfap57 UTSW 4 118606688 missense probably benign 0.00
R2322:Cfap57 UTSW 4 118610725 missense probably benign
R3905:Cfap57 UTSW 4 118595839 missense probably damaging 1.00
R4013:Cfap57 UTSW 4 118593143 missense probably benign 0.01
R4079:Cfap57 UTSW 4 118598997 missense probably benign 0.34
R4962:Cfap57 UTSW 4 118613065 missense probably benign 0.21
R4970:Cfap57 UTSW 4 118620371 missense probably damaging 0.99
R4974:Cfap57 UTSW 4 118593054 missense probably damaging 1.00
R4999:Cfap57 UTSW 4 118595848 missense probably benign 0.01
R5482:Cfap57 UTSW 4 118569641 missense probably benign
R5522:Cfap57 UTSW 4 118595888 missense probably benign 0.41
R5626:Cfap57 UTSW 4 118614783 missense probably damaging 1.00
R5685:Cfap57 UTSW 4 118569459 missense probably benign
R5712:Cfap57 UTSW 4 118614795 missense probably damaging 1.00
R5961:Cfap57 UTSW 4 118571745 missense probably benign 0.00
R6244:Cfap57 UTSW 4 118579410 missense probably damaging 0.99
R6268:Cfap57 UTSW 4 118569451 nonsense probably null
R6271:Cfap57 UTSW 4 118595759 missense probably benign 0.13
R6330:Cfap57 UTSW 4 118569396 missense probably benign
R6439:Cfap57 UTSW 4 118588975 critical splice donor site probably null
R6639:Cfap57 UTSW 4 118554712 missense probably benign 0.13
R6722:Cfap57 UTSW 4 118584717 missense probably damaging 1.00
R7033:Cfap57 UTSW 4 118613126 missense possibly damaging 0.67
R7143:Cfap57 UTSW 4 118620709 unclassified probably benign
R7162:Cfap57 UTSW 4 118614931 missense not run
R7174:Cfap57 UTSW 4 118589067 missense probably benign 0.35
R7210:Cfap57 UTSW 4 118576703 nonsense probably null
R7242:Cfap57 UTSW 4 118593096 missense possibly damaging 0.50
R7244:Cfap57 UTSW 4 118554800 nonsense probably null
R7359:Cfap57 UTSW 4 118598965 missense probably benign 0.01
R7373:Cfap57 UTSW 4 118614931 missense not run
R7401:Cfap57 UTSW 4 118614931 missense not run
R7412:Cfap57 UTSW 4 118614931 missense not run
R7414:Cfap57 UTSW 4 118614931 missense not run
R7452:Cfap57 UTSW 4 118595784 missense probably damaging 1.00
R7457:Cfap57 UTSW 4 118589001 missense probably damaging 0.97
R7559:Cfap57 UTSW 4 118614931 missense not run
X0022:Cfap57 UTSW 4 118614745 missense probably benign
Z1088:Cfap57 UTSW 4 118581882 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TATGACTAGCCAGCAGGTGC -3'
(R):5'- TTCACATGCGGCTACTATACC -3'

Sequencing Primer
(F):5'- GCAACACAGAAACTGCTGG -3'
(R):5'- GCGGCTACTATACCAAATACTATAAG -3'
Posted On2019-09-13