Incidental Mutation 'R7394:Grk4'
ID573648
Institutional Source Beutler Lab
Gene Symbol Grk4
Ensembl Gene ENSMUSG00000052783
Gene NameG protein-coupled receptor kinase 4
SynonymsGprk2l, A830025H08Rik
Accession Numbers

Genbank: NM_019497.2, NM_001080743.1

Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R7394 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location34660379-34755305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34751618 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 490 (N490Y)
Ref Sequence ENSEMBL: ENSMUSP00000001112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001112]
Predicted Effect probably benign
Transcript: ENSMUST00000001112
AA Change: N490Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001112
Gene: ENSMUSG00000052783
AA Change: N490Y

DomainStartEndE-ValueType
RGS 51 171 1.61e-31 SMART
S_TKc 186 448 7.78e-85 SMART
S_TK_X 449 528 2.98e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable, fertile and overtly normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Grk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Grk4 APN 5 34716290 missense probably damaging 0.99
IGL00574:Grk4 APN 5 34694818 missense probably benign 0.00
IGL02127:Grk4 APN 5 34710186 missense probably benign 0.00
IGL02191:Grk4 APN 5 34755189 missense probably benign 0.27
IGL02227:Grk4 APN 5 34694782 missense probably benign 0.06
IGL03152:Grk4 APN 5 34745357 missense probably damaging 1.00
IGL03214:Grk4 APN 5 34752209 missense probably benign
F5426:Grk4 UTSW 5 34745159 splice site probably benign
R0110:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0469:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0671:Grk4 UTSW 5 34748267 missense probably benign 0.04
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1584:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1605:Grk4 UTSW 5 34674557 missense probably damaging 0.98
R1607:Grk4 UTSW 5 34731538 missense probably benign 0.01
R1903:Grk4 UTSW 5 34676187 splice site probably null
R2352:Grk4 UTSW 5 34669176 missense probably benign 0.04
R4561:Grk4 UTSW 5 34694813 missense probably benign 0.00
R4580:Grk4 UTSW 5 34660981 missense probably damaging 1.00
R4807:Grk4 UTSW 5 34752208 missense probably benign
R5412:Grk4 UTSW 5 34745268 missense probably benign 0.00
R5905:Grk4 UTSW 5 34711730 missense probably damaging 1.00
R6360:Grk4 UTSW 5 34674537 missense probably damaging 1.00
R6604:Grk4 UTSW 5 34719864 missense probably damaging 1.00
R6865:Grk4 UTSW 5 34731550 missense probably damaging 1.00
R7265:Grk4 UTSW 5 34716264 missense probably damaging 0.96
X0064:Grk4 UTSW 5 34719884 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- ATTAAGGGAGCTCAGAGTTGC -3'
(R):5'- GAATAGCTGCCATGCTTCTGG -3'

Sequencing Primer
(F):5'- GGTGCTTTCCCAACATATGCAGG -3'
(R):5'- GCATAGTCTTGATTTACCTGTGATC -3'
Posted On2019-09-13